snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans Y37E3.20
sequence
CAAGCCTCCTGGCGCTGCTATTAGCCGGGATTCATAGGCTGGCGATGATTGAGATTGTT
CCCACACGCAATTTCTCCTGATCCACATGAAGGCTAAACTTCCTTGGACGTCTGAGCCGC
  Box motif
  Complementary to target RNA
length 119
organism Caenorhabditis_elegans
snoRNA name Y37E3.20
alias CeN33
chromosome ⁄ contig I
locus ⁄ host gene Y37E3.11
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:C400
accession no AM050149,NR_003391
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved