snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans F30H5.4
sequence
GTCCGTTGATGACAACATACATACACCATTACGATCTCTGAAGACTTCGTGCTGATCAT
GTATCCATGCAACACCAACTGAGGACA
  Box motif
  Complementary to target RNA
length 86
organism Caenorhabditis_elegans
snoRNA name F30H5.4
alias CeN15
chromosome ⁄ contig III
locus ⁄ host gene Mono:22:F30H5.4
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:C1502
accession no AM050843,NR_002638
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved