snOPY snoRNA Orthological Gene Database
Caenorhabditis_elegans B0334.12
sequence
GAATCTCAGACGGGGAAAGTTAATCTTCACAATAACTCAGTAGCAGAACTGGATATCAC
ATCACCGATTC
  Box motif
  Complementary to target RNA
length 70
organism Caenorhabditis_elegans
snoRNA name B0334.12
alias CeN118
chromosome ⁄ contig II
locus ⁄ host gene Mono:18:B0334.12
organization Mono
target RNA 26S rRNA
modification type C/D
modification site 26S:A1185
accession no AM050842,NR_001490
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved