snOPY snoRNA Orthological Gene Database
Aspergillus_nidulans snR61
sequence
CTTGCATGATGAGACAAATTTTTTTCAGTTCTGCTTCTGCAAACTTCTTGAAGAAAAAC
AAATACCATACCAAAAACTCCTGATGC
  Box motif
  Complementary to target RNA
length 86
organism Aspergillus_nidulans
snoRNA name snR61
alias snosnR61
chromosome ⁄ contig VII
locus ⁄ host gene poly:snR55
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved