snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U38-2
sequence
TGGGATGATGAATTGTAACAGCTTGATACGCCAGTTCTGCTTCAGATAATTCTTGATCG
AAAAAGCTGTATTCTTATCCGAGCCTTTCATTGCTATTTTGTCTTTCTTCTGAGT
  Box motif
  Complementary to target RNA
length 114
organism Arabidopsis_thaliana
snoRNA name U38-2
alias
chromosome ⁄ contig 1
locus ⁄ host gene poly:U36a-1
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:A1140,25S:G386
accession no NC_003070,CP002684
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved