snOPY snoRNA Orthological Gene Database
Arabidopsis_thaliana U14b
sequence
GTCGATGAGGATAAGATGAAGGCTTGTTTCTCAAAACATTCGCAGTGGCCGCCTAAGGC
TTTCGCCTTTCGCCGGGCTTGAGAGCTTATGATGTTTTTATCCTTCCTTGGATGTCTGAG
A
  Box motif
  Complementary to target RNA
length 120
organism Arabidopsis_thaliana
snoRNA name U14b
alias
chromosome ⁄ contig 4
locus ⁄ host gene poly:U14a
organization Poly
target RNA 25S rRNA, 18S rRNA
modification type C/D
modification site 18S:C416,25S:A2324
accession no NC_003075
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved