|
|
| Tupaia_belangeri SNORD21 | |
| sequence |
GCCGAATGATGATACCCCACTAACTGAGCAGTCGCTAGTTGGTCCTTTGGTTGCATATG
ATGTAATTATTGTTTCAAGACGGGACTGATGGCAGC
Box motif
Complementary to target RNA |
| length | 95 |
| organism | Tupaia_belangeri |
| snoRNA name | SNORD21 |
| alias | |
| chromosome ⁄ contig | GeneScaffold_5878 |
| locus ⁄ host gene | RPL5 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |