|
|
| Triticum_aestivum SNORD14 | |
| sequence |
TGGCGATGATGATTGAACAAAGGCTTGTTTCTCAAAACATTCGCAGATGCCGCCTAAGA
GCTTTCGCCCTGCCAGGCTTGAGAGCTAATGCTGCTAATTCCTTCCTTGGATGTCTGAGC CA
Box motif
Complementary to target RNA |
| length | 121 |
| organism | Triticum_aestivum |
| snoRNA name | SNORD14 |
| alias | |
| chromosome ⁄ contig | 4A |
| locus ⁄ host gene | Poly58:snoZ152 |
| organization | Poly |
| target RNA | 18S rRNA |
| modification type | C/D |
| modification site | 18S:C418 |
| accession no | JAGHKL010000010.1 |
| orthologs | list |
| multiple alignment | |