|
|
| Sorex_araneus SNORD70 | |
| sequence |
CTCAATGTTGTCAATGATGTATTCTTTTTGGAACTGAATTTAAGTGATCTAACTCAAAT
TCGTCACTACCACTGAGACAGCATTGAG
Box motif
Complementary to target RNA |
| length | 87 |
| organism | Sorex_araneus |
| snoRNA name | SNORD70 |
| alias | |
| chromosome ⁄ contig | GeneScaffold_356 |
| locus ⁄ host gene | ENSSARG00000013004 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |