snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae snR61
sequence
CTACAATGATGATAAAATTTACTATTCAGTTCTGCTTCTGAACCAAAATAATAGGAAGA
TAACCAATTTTACCAAAGCTCAAATCTGATT
  Box motif
  Complementary to target RNA
length 90
organism Saccharomyces_cerevisiae
snoRNA name snR61
alias Z11
chromosome ⁄ contig XII
locus ⁄ host gene Poly:2:snR61
organization Poly
target RNA 25S rRNA
modification type C/D
modification site 25S:A1133
accession no AF064273,BK006945
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved