|
|
| Rattus_norvegicus SNORD38 | |
| sequence |
CTTCTTGTGATGAAAATACTGTCCAGTTCTGCTACTGAAGGAATGAGATGAATACTTTA
GTGCTGAAGAAG
Box motif
Complementary to target RNA |
| length | 71 |
| organism | Rattus_norvegicus |
| snoRNA name | SNORD38 |
| alias | |
| chromosome ⁄ contig | 5 |
| locus ⁄ host gene | Rps8 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |