|
|
| Physcomitrium_patens SNORD14 | |
| sequence |
agtcgatgacaataaacctttaggcttgtttctgaaacattcgcagtggccgtctaaag
ctttcggcccgctgggcttgagagctgatgcagcttccaaaccttccatggatatttgag act
Box motif
Complementary to target RNA |
| length | 122 |
| organism | Physcomitrium_patens |
| snoRNA name | SNORD14 |
| alias | |
| chromosome ⁄ contig | 14 |
| locus ⁄ host gene | Poly7:snoZ43 |
| organization | Poly |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | ABEU02000014.1 |
| orthologs | list |
| multiple alignment | |