|
|
| Oryza_sativa SNORD24 | |
| sequence |
atctgggtgatgaagaaaatcagacggattcccattggttttccaatatgattttaaca
accagctacttctgacagat
Box motif
Complementary to target RNA |
| length | 79 |
| organism | Oryza_sativa |
| snoRNA name | SNORD24 |
| alias | |
| chromosome ⁄ contig | 3 |
| locus ⁄ host gene | LOC4334154 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | NC_029258.1 |
| orthologs | list |
| multiple alignment | |