snOPY snoRNA Orthological Gene Database
Mus_musculus SNORA55
sequence
TTCCCAGGCCTGCTGCTTGGTGCCAGTCTGGGGACAGAGGAAATCCAGACGGGTTGTTT
CCATCTGTCCTGAGGTGTGTCTCTACAACTCTGCCACACTT
  Box motif
  Complementary to target RNA
length 100
organism Mus_musculus
snoRNA name SNORA55
alias ACA55
chromosome ⁄ contig 2
locus ⁄ host gene Mono:509:SNORA55
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U36
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved