|
|
| Macaca_mulatta SNORD38 | |
| sequence |
TCTCGTGATGAAACCTCTGTCCAGTTCTGCTACTGAAGGGAGAGAGATGAGAGCCTTTA
GGCTGAGGAA
Box motif
Complementary to target RNA |
| length | 69 |
| organism | Macaca_mulatta |
| snoRNA name | SNORD38 |
| alias | |
| chromosome ⁄ contig | 1 |
| locus ⁄ host gene | ENSMMUG00000015270 |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |