snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD14B
sequence
TCACTATGATGATTGGTTGCCAGACATTCGCAGTTTCCACCAGAAATGTTTTTCCTTAT
GTTGGCCAGTTCTTCCTTGGATGTCTGAGTGA
  Box motif
  Complementary to target RNA
length 91
organism Homo_sapiens
snoRNA name SNORD14B
alias U14B
chromosome ⁄ contig 11
locus ⁄ host gene RPS13
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:C462
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved