snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD66
sequence
TTCCTCTGATGACTTCCTGTTAGTGCCACGTGTCTGGGCCACTGAGACACCATGATGGA
ACTGAGGATCTGAGGAA
  Box motif
  Complementary to target RNA
length 76
organism Homo_sapiens
snoRNA name SNORD66
alias HBII-142
chromosome ⁄ contig 3
locus ⁄ host gene EIF4G1
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:C1272
accession no NR_003055,NT_005612
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved