snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD82
sequence
ACAGCACAAATGATGAATAACAAAGGGACTTAATACTGAAACCTGATGTTACATTGTAG
TGTGCTGATGTGCTGT
  Box motif
  Complementary to target RNA
length 75
organism Homo_sapiens
snoRNA name SNORD82
alias U82,Z25
chromosome ⁄ contig 2
locus ⁄ host gene NCL
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A1678
accession no NR_004398,NT_005403
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved