snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD70
sequence
TTCGTTGTTGTCAATGATGTATTCTTCTTGGAACTGAATCTAAGTGATCTGACTCAATA
TTCGTCACTACCACTGAGACAACGATGAA
  Box motif
  Complementary to target RNA
length 88
organism Homo_sapiens
snoRNA name SNORD70
alias HBII-234
chromosome ⁄ contig 2
locus ⁄ host gene NOP5/NOP58
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A512
accession no NR_003058,NT_005403
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved