|
|
| Erinaceus_europaeus SNORD57 | |
| sequence |
TGGAGGTGATGAACTATTATTAGCCTGACTTTGTAGACTGGAGGCAAAAAAACTGATTT
AATGAGCCTGATCC
Box motif
Complementary to target RNA |
| length | 73 |
| organism | Erinaceus_europaeus |
| snoRNA name | SNORD57 |
| alias | |
| chromosome ⁄ contig | GeneScaffold_5096 |
| locus ⁄ host gene | NOL5A |
| organization | Intronic |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | |
| orthologs | list |
| multiple alignment | |