|
|
| Danio_rerio SNORD24 | |
| sequence |
TGCAGATGATGTAATGAATATTTGCTATCTTAACAGCAATGCAGACAATCTCCCACCAA
GATCGCTGATGCA
Box motif
Complementary to target RNA |
| length | 72 |
| organism | Danio_rerio |
| snoRNA name | SNORD24 |
| alias | |
| chromosome ⁄ contig | 5.0 |
| locus ⁄ host gene | rpl7a |
| organization | Intronic |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | |
| accession no | NC_007116.6 |
| orthologs | list |
| multiple alignment | |