|
|
| Canis_familiaris SNORD24 | |
| sequence |
TGCAGGTGATGTGAAGGAATATTTGCTATCCGAGAGTTGGTGATGACGCTTGAAACCAC
CAAGATCGCTGATGCA
Box motif
Complementary to target RNA |
| length | 75 |
| organism | Canis_familiaris |
| snoRNA name | SNORD24 |
| alias | |
| chromosome ⁄ contig | 9 |
| locus ⁄ host gene | Q9XST8_CANFA |
| organization | Intronic |
| target RNA | 18S rRNA |
| modification type | C/D |
| modification site | 18S:U966 |
| accession no | |
| orthologs | list |
| multiple alignment | |