|
|
| Aegilops_tauschii SNORD14 | |
| sequence |
TGGCAATGATGATAAATTTAAGGCTTGTTTCTCAAAACATTCGCAGTTGCTGACTAAGA
GCTTTCGCCCAGCCAGGCTTGAGAGCTAATGCTGCTAATTCCTTCCTTGGATGTCTGAGC CT
Box motif
Complementary to target RNA |
| length | 121 |
| organism | Aegilops_tauschii |
| snoRNA name | SNORD14 |
| alias | |
| chromosome ⁄ contig | 4D |
| locus ⁄ host gene | Poly29:SNORD14 |
| organization | Poly |
| target RNA | 18S rRNA |
| modification type | C/D |
| modification site | 18S:C409 |
| accession no | NWVB02000004.1 |
| orthologs | list |
| multiple alignment | |