|
|
| Aegilops_tauschii SNORD24 | |
| sequence |
AGCCAGTGATGTTATCAAAATATTTGCTACTCTTGATGGGGTAACGACCCCATTTGATG
ATCACAACCACCAAGATCTCTGAGGTC
Box motif
Complementary to target RNA |
| length | 86 |
| organism | Aegilops_tauschii |
| snoRNA name | SNORD24 |
| alias | |
| chromosome ⁄ contig | 6D |
| locus ⁄ host gene | Poly7:SNORD14 |
| organization | Poly |
| target RNA | |
| modification type | C/D |
| modification site | |
| accession no | NWVB02000006.1 |
| orthologs | list |
| multiple alignment | |