snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD46
sequence
GTAGGGTGATGAAAAAGAATCCTTAGGCGTGGTTGTGGCCGTCTTGGTCACCTGTGTGC
CACTTGCCAATGCAAGGACTTGTCATAGTTACACTGACT
  Box motif
  Complementary to target RNA
length 98
organism Homo_sapiens
snoRNA name SNORD46
alias U46,U40
chromosome ⁄ contig 1
locus ⁄ host gene RPS8
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A3739
accession no NR_000024,NT_032977
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved