snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD32A
sequence
GTCAGTGATGAGCAACATTCACCATCTTTCGTTTGAGTCTCACGGCCATGAGATCAACC
CCATGCACCGCTCTGAGA
  Box motif
  Complementary to target RNA
length 77
organism Homo_sapiens
snoRNA name SNORD32A
alias U32A
chromosome ⁄ contig 19
locus ⁄ host gene RPL13A
organization Intronic
target RNA 18S rRNA, 28S rRNA
modification type C/D
modification site 18S:G1328,28S:A1511
accession no NR_000021,NT_011109
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved