|
|
| Homo_sapiens SNORD18C | |
| sequence |
TTGTTATGATGAGATTCCACTTAAGGTCCGTGTTTCTGAAACAAATGATTTTGTGGAAG
TTCTGATTTA
Box motif
Complementary to target RNA |
| length | 69 |
| organism | Homo_sapiens |
| snoRNA name | SNORD18C |
| alias | U18C |
| chromosome ⁄ contig | 15 |
| locus ⁄ host gene | RPL4 |
| organization | Intronic |
| target RNA | 28S rRNA |
| modification type | C/D |
| modification site | 28S:A1313 |
| accession no | |
| orthologs | list |
| multiple alignment | |