snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD58B
sequence
CTGCGATGATGGCATTTCTTAGGACACCTTTGGATTAATAATGAAAACAACTACTCTCT
GAGCAGC
  Box motif
  Complementary to target RNA
length 66
organism Homo_sapiens
snoRNA name SNORD58B
alias U58B
chromosome ⁄ contig 18
locus ⁄ host gene RPL17
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:U4197,28S:G4198
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved