snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD58C
sequence
TTGCTGTGATGACTATCTTAGGACACCTTTGGAATAACTATGAAAGAAAACTATTCTGA
GCAAC
  Box motif
  Complementary to target RNA
length 64
organism Homo_sapiens
snoRNA name SNORD58C
alias U58C
chromosome ⁄ contig 18
locus ⁄ host gene RPL17
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:U4197,28S:G4198
accession no AM413028
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved