snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis
18S rRNA
NW_004668393
274
GTAAGTGCGGGTCATAAGCTCGCGTTGATTAAGTCCCTAGCCCTTTGTACACACCGCCCG
TCGCTACTACCGATTGGATGGTTTAGTGAGGTCCTCGGATCGGCCCCGCCGGGGTCGGCC
ACGGCCCTGGCGGAGCGCCGAGAAGACGATCAAACTTGACTATCTAGAGGAAGTAAAAGT
CGGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGAGGCCGCCGAGG
GGGCGCCACGGGGCCTCGACGAAACGAGCGCGCC
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved