snOPY snoRNA Orthological Gene Database
Tupaia_belangeri
28S rRNA
NW_006204218
4077
tgtgacctcagatcagacgtggcgacccgctgaatttaagcatattagtcagtgtaggaa
aagaaactaaccagaattccctcagtaacagcgagtgaacagggaaaagctcaatactga
atccccgccccgcggtggagcgtgggacatgtggcatatggaagacccactccccggcgt
cgttcgtggggggcccaagtccttctgatcgaggcccagcccatggacagtgtgaggcca
gtagtggcccccggcgcaccaggcccaggtcttcccagagttgggttgcttgggaatgca
gcccaaagcaggtggtaaactccatctaaggctaaataccagcacgagaccaatagtcaa
caagtaccgtaagggaaagttgaaaagaactttgaagagagagttcagagggcatgaaac
cattaagaggtaaacgggtggtgtccacgcagtttgcccagaggattcaacccaacagca
catccggctgtgttggtggtctcccggtggatctttcccaccccccattcctcctggccc
atctacccgtcctccctcccccaccacgacccccttcctcagggaggggcactacgacgg
gtgtgggggtggggaaggtgggggatcgccccccggctggcgactggccgctgccaggcg
cacctccaccatcagcggtgcaccacaaccagctccgggacagctgggaaggccctcgtg
gggcagcggagccaacccttcccgagtgttacagccccgtggctgcagcatgctcaccaa
gtcccagggccgagggagcccaggacccatcaccgtgctctcccacctggcacccacccc
catgcagaggcccccccccacgaggggaggcatcccccatgggggcacgccagtgtctct
tgggggggccaggctgcccctcctatggcactaccgctcctccactgcccccacctgtcc
ccgccatgcctcttcccgaggtggggtgggtcgggtgcggggtcggcagggcggactgtc
cccagtgtgacctaggtgggctcgggggatgtttccaggtgccacgtcactaagcaaagt
gcgtgcacggggttggcggcaatgtcagctacccacctgaccagtcttgaaacacggacc
aaggagtctaacacctgcgcgagttgggggctcgcacgaaagccgctgtggtgcaatgaa
ggtgaagggctggaggccgcggtggcgcccgtcgccgctgctcaccgccggccagaggtg
ggattccgaggcctctccagtccgccaagggcacacctctggcccgtctcacccaccacg
ctggggaggtggagcacgagcgcacatgttagaacctgaaagatggagaactatgcctgg
acagggtgaagccagaggaaactctggtggaggtccatagtggtcgtgacgtgcaaatcg
gtagtccaacctgggtataggggcaaaaaactaatcgaaccatctagtagctggttccct
ccgaagtttccctcaggatagctggcgctctctcaagacctgaaccacgcagttttatct
ggtaaagcgaatgattagaggtcttggggctgaaacgatctcaacctattctcaaacttt
aaatgggtaagaagcctggctcactggcatggagctgggtgtggaatgcgagtgcctagt
gggccacttttggtaagcagaactggcgctgcaggatgaaccgaatgccgggttaaggtg
cccgatgccgatgctcatcagaccccagaaaaggtgttggttgatatagacagcaggacg
gtagccatggaagttggaatccactaaggagtgtaacaattcacctgccgaatcaactag
ccctgaaaatggatggcactggagcatcgggcccataccctgccattgctggcagtcgag
cacacattgagagggggacaggagccttcccaaacccaccacggatgctacaccatgacg
agtaggagagccactatggtgagtcttgaagcctatggtgcgggcccgggtggcgctgcc
acaggtgcagatcttggtggtagtagcaaatattcaaatgagaactttgaaggccaaagt
ggagaaaggttccatgtgaacagcagttgaacatgggtcagtcggtcctgagagatgggt
gagtgccattctgaagggatgggcgatggcctctgttgccctcggccgatcaaaagggag
ttgggttcagatctccaaatccgaagtggcggagatgggtgccacgaggcatccagtgca
gtaatgcaactgtcccagagaagctggcgggatccccagggagagttctcttttctttgt
gaaggacatggctccctggaatgggttcgccccaagagaggggcccatgccttggaaagt
gtcgcggttccagcggtgtccggtgagctctcgctggcccttgaaatttggggcagaggg
tgtaaatctcacgccaggctgtacccgtatctgcagcaggtccccaaggtgaacagcctc
tggcatgttggaacaatgtaggtaagggaagttgacaagctggatccgtaattttgggat
aaggattggctctaagggctgggttggtcgggctggggcacgaagcggggctgggtatgt
gctgtgactggatgaggcgcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncc
agatcggggggcaacactggctggtggtgcagcgtgagcactgggtgtccccgcccatcg
tcccacttgcccatctctctctcccacccccattccaccctgtcccatggtggcagacca
cattgatccccccctgctgggtctgcccccgtggccatggttctgtgtggcacctcagct
cggccggcgtctagcagccaaattagaactggtgtggaccaggggaatctgactgtttaa
ttaaaacaaagcatcacaaaggcccatggcgggtgttgacgcgatgtgatttctacccag
tggtctgaatgtcaaagtgaaaaaattcaatgaagcactggttaatggggggagtaacta
tgactctctttaggtagccaaatgcctcgtcatctaattagtgacgtgcatgaatggatg
aacgagattcccactgtccctgtctactatccagcgaaaccacagtcaagggaacaagct
tgatggaatcagtggggaagaagaccctgttgagcttgactctagtctggcacagtgaag
agacatgagaggtatagaataagtgggaggtctccggcgccctcccgcccccatgagggg
gtgggacggggtctgctggccttgagggctgccagtgaaataccactactcttatcgttt
tttcactgagccagtgaggtgcagggcgagccccaagggcctctcacttctggcaccaag
cgactggctggcatcagctgggcacaactcgctctgggaacagtgccaggtggggagttt
gactggggcggtacacctgtcaaatggtaacgcaggtgtcctaaggcgagttcagggagg
acagaaacctcccgtggaatggaagggcaaaagctcgcttgatcttgattttcactacaa
atacagaccatgaaagtggggcctcatgatccttctgactttttgggttttaagcaggag
atgtcagaagagtcaccacagggataactggcttgtggcagccaagtgttcatagtgacg
tcgctttttgatccttcgatgtcggctcttcctatcattgtgaaacagaattcaccaagc
gttggattgttcacctactaatagggaacgtgagctgggtttagaccatcatgagacaga
ttagttttaccctactgatgatgtgttgttgccatggtaatcctgctcagtatgagagga
accgcaggttcagacatttggtgtatgtgcttggctgaggagccaatggggcagagctac
catctgtgggattatgactgaacgcctctaagtcagaatcccgcccaggtggtatgatac
agtagtgccgtggagcctcggttgaccttggatagccagtnnnnnnnnnnnnnnnnn
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved