snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus
28S rRNA
AAQQ01485392,AAQQ01771942
1640
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCGCGCCGGTCTTCCCCGCCGGGTCCGCCCCGGGCCGCGGTCCCGCGCGGGGCCCCGCCT
TCAGCCGGGCGCCTAGCAGCCGACTTAGAAACTGTTGCGACCAGGGGGAATTCGACCTGT
TTTATTATAAACAAAAGCATCGCGAAGGCCCGCGGCGGGTGTTGACGCGATGTGATTTCT
GCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGTGTAACGGGCGGGA
GTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTAATTAGTGACGCGCATGA
ATGGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGCCAAGGGA
ACGGGCTTGCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTCTGGCAC
GGTGAAGAGACATGAGAGGTGTAGAATAAGTGGGAGGCCCCCGGCGCCCCTCCGTCCCCG
CGAGGGGGCGGGGCGGGGTCCGCCGGCCTTGCGGGCCGCCGGTGAAATACCACTACTCTT
ATCGTTTTTTCACTGACCCGGTGAGGCGGGGGGGCGAGCCCCGAGGGGCTCTCGCTTCTG
GCGCCAAGCGCCCGGCCGCGCGCCGGCCGGGCGCGACCCGCTCCGGGGACAGTGCCAGGT
GGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGC
TCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAAAAGCTCGCTTGATCTTGATTT
TCAGTACGAATACAGACCGTGAAAGCGGGGCCTCACGATCCTTCTGACCTTTTGGGTTTT
AAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGTTC
ATAGCGACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGAAT
TCACCAAGCGTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGTCG
TGAGACAGGTTAGTTTTACCCTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGT
ACGAGAGGAACCGCAGGTTCAGACATTTGGTGTATGTGCTTGGCTGAGGAGCCAATGGGG
CGAAGCTACCATCTGTGGGATTATGACTGAACGCCTCTAAGTCAGAATCCCGCCCAGGCG
GAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGTCCCCCGCCGT
CCCCGCCGGCGGGCCGCCTCGCGTCTGCGCGCGGGGCGTGTCCCGCCGCGCGTCGGGACC
GGGGTCTGGTGCGGAGAGCCCTTCGTCCTGGGAAACGGGGTGCGGCCGGAAAGGGGGCCG
CCCTCTCGCCCGTCACGTAACGCACGTTCGTGGGGGACCTGGGCGCAAAGCCTTCTCATA
CTAACCCGCTTCGGGTGGGGTATTCGAAAGGAGCAGAGAACTTCCCTCATTGTACCTATT
GAAAAGCAGACCTTCCACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNN
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved