snOPY snoRNA Orthological Gene Database
Sorex_araneus
28S rRNA
NW_004545933,NW_004546038
4610
ctcgacctcagatcagacgtgtcgacccgctgaatttaagcatattagcggaggaaaaga
aactaaccaggattctctcagtaatggcgagtgaacagggaagagcccagcgccgaatcc
ctgcccctcggtggggcgcgggacatgtggcgtatggaagactcactccccggcgccgct
cgtggggggcccaagtctttctgatcgaggcccagccagtggacggtgtgaggccggtcg
tggcccccggcgcgccgggtccgggtcttcccggagtcgggttgcttgggaatgcagccc
aaagcgggtggtaaactccatctaaggctaaataccggcacgagaccgatagtcaacaag
taccgtaagggaaagttgaaaagaactttgaggagagagttcaagagggcgtgaaaccgt
taagaggtaaacgggtggggtccgcacagtccgcctagaggattcaacccggcggcgcat
ggccggccgtgcccgcggtccagcggatctttcccgcccccgttcctcccgacccctcca
cccgtcctctctccgccccgtcgtctgcggcggagtgcgggggtgggtgggcagggccgg
ggttggggtcagtgggggactgcccccggctggcgaccggccgccgccaggcgcatttcc
accttggcggtgcgccgcgactggctcagggacggctgggaaggcccggcggggaaggtg
gctcaggggggcccccctggccctctcgggggtcgggtctcaccccccgagtgttacagt
cccccggcagcagcgttcgccaaatcctggggctgagggagccagacccgtcaccgcgct
ctcccccctcctggcgctcacccccgcgggggccctgcgagggggtcccccctccgtggg
ggcataccggtgccagggggccgggcctcccctcccacggcacgaccgctcccccacccc
ctccgtccctggcgacggggcgtgggggggtggggcggactgtccccagtgcgccccggc
gagtcgcgccgtcgggcctggggggtctccgaggccacgccgccacactaccaagcgggg
cgaagcgagcgcacggggtcggcggcgagatgtcagccacccacccgagccgtcttgaaa
catggaccaaggagtctaacacgtgccgtgagtcaggggcttgcccgaaagccaccgtgg
cacaatgaaggtgaaggttacaaccgtccccatcctcctcccgtctctctcccctcctcg
tcccatcatccctcggggcacgcgggtccgggattgggggggggcgggtcgggggggcgc
ggaccggcggacgggctgaggtgggatcccgaggcctctccagtacgccgagggcgcacc
accggcctgtctcgcccgccgcaccggggaggtggagcacgagcgcacgtgttaggaccc
gaaagatggtgaactatgcctgggcagggcgaagccagaggaaactctggtggaggtccg
tagcggtcctgacgtgcaaatcggtcgtccgacctgggtataggggcgaaagactaatcg
aaccatctagtagctggttccctccaaagtttcccttaggatagctggcgctcttgcatg
accacccacgcatttttatccggtaaagcgaataattagaggtcttggggccgaaacgat
ctcaacctattctcaaactttaaatgggtaagaagtccggctcactggcatggagcgggg
catggaatgcgagtgcctagtgggccacttttggtaagcagaactggtgccgcaggatga
accaaacgccgggttaaggcgcccaatgccaatactcatcagaccccagaaaaggtgttg
gttgatatagacagcaggacggtggccatggaagtcggaatccgctaaggagtgtgtaac
aactcacctgccgaatcaactagccctgaaaatggatggcgctggagcgtcgggcccata
cccagctgccgctggctgtccgtgatgcgtgagagggggatgagagcgcccggtgggccc
atccagagagatgggcccttccccatgacaagtaggagggccgctgtggtgagccttgaa
gcctagggcgcgggcccgggtggagccgccgcaggtgcagatcttggtggtagtagcaaa
tattcaaatgagaactttgaaggccaaagtggagaagggttccatgtgatcagcagttga
acatggatcagtcggtccggagagatgagcgagcaccattcggaagggaggggcgattgc
ctccgttgccctcggcgatcaaaagggagtcgggttcagatccccgaatccggagtggcg
gagacgggtgccgcaaggcgtccagtgcggtaacgcaaccgatcccggggaagccggcgg
gagccccggggagagttttcttttctttgtgaagggcagggcgccctggaatgggttcgc
cccgagagaggggcccgtgccttggaaagcgtcgcggttccggcggcgtccggtgagctc
tcactggcccttgaaaatccgggggagagggtgtaaatctcacgccgggccgtacccata
tccgcagcaggtctccaaggtgaacagcctctggcatgttggtaagagaagtcggcaagc
tggatcgtaacttcgggataaggattggctctaagggctgagttgatcgggctggggcac
gccgcgggtggatgaggtgccaccgcccgccccccatgcccagggcacccctggcaggcc
cgccccgaccccgctcccccgggggtctctctccctcaaccctcccccggccccgcagcc
tgggcgggcgtgggggtggaagcctgcggtccccgtgcgggggggcccccagcagtgggg
ggccgggtccccctcagggcctcgggcaccagggggcccgcaccggcggtgactctggac
gtgagcagggcccttcccgtggatcaccccagctgtggcgggcgtcgcggccgtcccagg
ggagcccggtgggcgccagcgcttgccggcaggccgggctgggtgctgagggggtttgcc
ccccccctcgtcccctgctgcccccggcttctgtgccagtctcccccgccaggaccgcct
cctgcccacagttctgtgctgtgcctcgcctccgccggcgcctagcagccgacttagaac
tggtgtggaccaggggaatccgactatttaattaaaacaaagcatcgcgaaggcccgcgg
cgggtgttgacgcgatgtgatttctgcccagtgctctgaatgtcaaagtgaagaaattca
atgaagcggataaacggcaggagtaactgactctcttaaggtagccaaatgcctcgtcat
ctaattagtgacgcacatgaatggatgaaggagattcccactgtccctacctactatcca
gcgaaaccacagccaagggaatgggcttggcagaatcagcggggaaagaagaccctgttg
agcttgactctagtctggcacagtgaagagacatgagaggtgtagaataagtgggaggcc
cccagcaccccctgtccacgagagggggtgaggcagggtccaccggccatgtggggccgc
cggtgaaataccaatacattgatcattttttcactgacccagtgaggtgggggaggggtc
aagcccctaggggctctcgcttctggcgccaagcatccggccgcacgctggttgggcgag
acccgctccagggacagtgccaggtggggagtttgactggggcggtacacctgtcaaacg
gtaacgcaggtgtcctaaggcgagctcagggaggacagaaacctcccgtggagcagaagg
gcaaaagctcgcttgatcttgattttcagtacgaatacagaccgtgaaagcggggcctca
cgatccttctgacctttggggttttaagcaggaggtgtcagaaaagttaccacagggata
actggcttgtggcggccaagcgttcatagcgacgtcgctttttgatccttcgatgtcggc
tcttcctatcattgtgaagcagaattcaccaagcgttggattgttcacccactaataggg
aacgtgagctgggtttagacagtcatgagacaggttagttttaccctactgatgatgtgt
tgttgccatggtaatcctgctcagtacgagaggaaccgcaggttcagacatttggtgtat
gtgcttggctgaggagccaatggggcgaagctaccatctgtgggattatgactgaatgcc
tctaagtcagaatcccacccaggcggaacgatatggcagccccgatgggaaccttggtgg
gctctggctagccggttcccgctgtccccgccagtgagccgcgccttcaccgacgtgtac
cccgtggtgcatcgggaccagggtccagtgcagaaagcctctggtctcaggaactggggc
gcggccggaaaggcggctgcccccttgcccatcatgcaacgcacgttagtggggaacctg
gtgctaaaccattcatagaggacctgcttctgggtcagggtttcatacgtagcagagcag
ctccctcgctgcgatctattgaaagtcagccctcgacacaagggtttgtc
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved