snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae
U2 snRNA
M14625
1171
ACGAATCTCTTTGCCTTTTGGCTTAGATCAAGTGTAGTATCTGTTCTTTTCAGTGTAACA
ACTGAAATGACCTCAATGAGGCTCATTACCTTTTAATTTGTTACAATACACATTTTTTGG
CACCCAAAATAATAAAATGGACGGGAAGAGACTTTTTAAGCAAGTTGTTTTCCGCTAATG
TCAGGTCTCACTACTTTTTGCTGCTATTTTTCTTCGCTCATGGTTTCTTCATAAGGCGTT
TTTATGATGGTTTTTCGAAATTGGTTTTTGAGACGACGGTTGCTCAAGGTTATTGTTTTT
GTTTTCTTCTGGTTGTTTTCTATTTTCTTTTTTTTAGCTTTCTGTTTCTCCCTTAGTTTG
GCTTTTTGCTTCATACTCTTCCCTGTCTTTCCGAGCCGTTTATGTCCAACGCGGGATTTG
GTTTTTCTTTATCGATGGGAAGAAATGGTGCTATAGTAGGTTGGGAGATAATATTTATGG
TATGGGGTGCTAGTGCGGATGGGGCGCTCTTATTGTTGATTTCTTCGCTCGTCTTCTTTT
TCTGGTGGCGCTGCAAGAGGAAGTTTTTCGACTTTGTTATGATTTTTGGTTTGCAAGGAA
AGGTGTCTTACGATTCTTTTTTTGATGTAATAGGATAAGCTTGCTTATCCCCAAGTATCG
GCCAAAGTTGTTGATTTTCCTTTTGAAGTGTCCTCGGTTTGAGGGGGTGTAGGGTGGGGT
TGGTCTACAATAAGAGTGTTCCATTGTTAACGTGCTGGCGTCTTTTACTATATTTTTTTT
CCCAGTTTATTTTGTGCTTATTTTCTCATTGAGGAGAAGGAGCTCTTCTCGCAGGATATA
AATGGAGGTTTGCTAAAGGGGAGGAGATGTGTTTGTGAGAATACTGCTGAGAGAGTTCTG
GAAGAGAAAAAAAGGAGGCAATGGAAGGCGTTTGCTGGGAAAAGAGAAGAGCCATGACTG
CATCTGTTGTTTCAAGGCCAGTTTTATTAACCGCCTATGTCATAGAGGCGTTTTTTTTGG
AGGGATTTGAAGAATGCCCGGCGGCATCAAGAAACGGACTTGATGGTTGACGCCTGTTTT
TAAAGTTAGAGACGTCGCGACCCTCGCACTTGTGGAGTCGTTCTTGACTTTTACTTTGGT
CGCTTGATGTTTCTCTCGTCTTCCCGTTCGC
snR81 U2:U42,25S:U1052 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved