snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae
5.8S rRNA
K01048
158
AAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGAT
ACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCC
TTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTT
snR43 5.8S:U73,25S:U966 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved