snOPY snoRNA Orthological Gene Database
Rattus_norvegicus
28S rRNA
V01270
4786
CGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTCAGCGGAGGAA
AAGAAACTAACCAGGATTCCCTCAGTAACGGCGAGTGAACAGGGAAGAGCCCAGCGCCGA
ATCCCCGCCGCGCGCCGCGGCGCGGGAAATGTGGCGTACGGAAGACCCACTCCCCGGCGC
CGCTCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCCAGCCCGTGGACGGTGTGAGGCCG
GTAGCGGCCCCGGCGCGCCGGGCCCGGGTCTTCCCGGAGTCGGGTTGCTTGGGAATGCAG
CCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGCCAAC
AAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAAC
CGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCCGCCCGGAGGATTCAACCCGGCGGCG
CGCGCCGGCCGGCCGGTGGTCCCGGCGGATCTTTCCCGCTCCCCGTTCCTCCCGACCCCT
CCACCCGCGCGTCTCTCTCCCCCCTCCCCGCGTCCCGCCGTCGCCGTCCCCGCTCCTCCC
TCCGGGGGGGTGTCGGCGGGCGCTCCGGCGGCGGGCGCGGGGTGTGGTGGGGGCGCGCGG
GCGGGGCCGGGGGTGGGGTCGGCGGGGGACCGCCCCCGGTCGGCGACCGGCCGCCGCCGG
GCGCACTTCCACCGTGGCGGTGCGCCGCGACCGGCTCCGGGACGGCTGGGAAGGCCCGGC
GGGGAAGGTGGCTCGGGGGGGGCGGCGTCACCCGTGGGCGCCGGACCACCCCGCCCCGAG
TGTTACAGCCCCCCGGCAGCAGCGCTCGCCGAATCCCGGGGCCGAGGGAGCCGGATACCC
GTCGCCGCGCTCTCCCCCCGGCCTCTCCCCTCCCGCCCCTCCCCGTGGGGTGGCGGAAAG
GGGGGCGGTCGCGGGGGCCGGGCCGCCCCTCCCACGGCGCGACCGCTCTCCCACCCCCCG
TCGCCTCCGTCGTCCCTCTCGGGGGTCCGGGGGCCCGGGGGGCGGGGCGGACTGTCCCCA
GTGCGCCCCGGGCGTCGTCGCGCCGTCGGGCCCGGGGGGGCCGTCGTCACGCGCTCTCCC
TCCCCTTCTCGGGGTGGGGGGGAGCGAAGCCGAGCGCACGGGGTCGGCGGCGATGTCGGC
TACCCACCCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGCGTGCGCGAGTCAGGG
GCTCGTCCGAAAGCCGCCGTGGCGCAATGAAGGTGAAGGGCCCCGTTCCCGGGGGCCCCG
AGGTGGGATCCCGAGGCCTCTCCAGTCCGCCGAGGGCGCACCACCGGCCCGTCTCGCCCG
CCGCGCCGGGGAGGTGGAGCACGAGCGTACGCGTTAGGACCCGAAAGATGGTGAACTATG
CTTGGGCAGGGCGAAGCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCTGACGTGCAA
ATCGGTCGTCCGACTTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTT
CCCTCCGAAGTTTCCCTCAGGATAGCTGGCGCTCTCGCAACGCGTTCGCTCGACAACCCG
CAGTTTTATCCGGTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTAT
TCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGATGCG
AGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCG
GGTTAAGGCGCCCGATGCCGACGCTCATCAGACCCCAGAAAAGGTGTTGGTTGATATAGA
CAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAGGAGTGTGTAACAACTCACCTGCC
GAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGC
CGGCAGTCGGAACGGGACGGGAGCGGCCGCGGGCGCGCGACCCCGGGGGCCGGGCGGCGT
CGGCTTCGGCCGGCCGCCGCCCGTCCACCCCCGGGGCTCCCCCCGCGGCGTCGGGCCCCG
CGGAGCCTACGCCGCGACGAGTAGGAGGGCCGCTGCGGTGAGCCTTGAAGCCTAGGGCGC
GGGCCCGGGTGGAGCCGCCGCAGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGA
GAACTTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAG
TCGGTCCTGAGAGATGGGCGAGTGCCGTTCCGAAGGGACGGGCGATGGCCTCCGTTGCCC
TCAGCCGATCGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCG
CCGCGAGGCGTCCAGTGCCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCGGG
GAGAGTTCTCTTTTCTTTGTGAAGGGCAGGGCGCCTTGGAATGGGTTCGCCCCGAGAGAG
GGGCCCGTGCCTTGGAAAGCGTCGCAGTTCCGGCGGCGTCCGGTGAGCTCTCGCTGGCCC
TTGAAAATCCGGGGGAGAGGGTGTAAATCTCGCGCCGGGCCGTACCCATATCCGCAGCAG
GTCTCCAAGGTGAACGCCTCTGGCATGTTGGAACAATGTAGGTAAGGGAAGCGGCAAGCC
GGATCCGTAACTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGCGC
GAAGGCGGGGCTGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGCCCCCCTCCCACGTC
CGGGGAGACCCCCTCCTTTCCGCCCGGGCCCGCCCTCCCCTCTCCCCGCGGGGCCCCGCC
GTCCCCCGCGTCGTCGCCGTGGTCCCCTCCTCCCTCCCTTCTTCCCCGTCCGCGGGGGGG
ACGGGGCGGGTGCGGGGGGGCGCGCGCGCGCGCGGCCCAGGGGCGGCGGGTCCAACCCCG
CGCGGGCCGGAGCGGGGGGAACCCGCGGGCCCCCGGTGGGGGGGGGCCCGGACACCCGGG
GGGGACCGGCGGCGGCGGCGACTCTGGACGCGAGCCGGGCCCTTCCCGTGGATCGCCCCA
GCTGCGGCGGGCGTCGCGGCCGCTCCCGGGGAGCCCGGCGGGTCGCCCGGCGGGGTTTTC
CTCCGGCCTCGTCCTCCCCCTTCCCCCTCCGCGGGGTCGGGGGTTCCCGGGGTTCGGGGT
TCTCCTCCGCGCGGCGGTTCCCCCGCCGGGTGCGCCCCCCGGGCGCGGTTTCCCGCGGCC
GCCCGCCTCGGCCGGCGCCTAGCAGCCGACTTAGAACTGGTGCGGACTAGGGGAATCCGA
CTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGTTGACGCGATGTGATTT
CTGCCCAGTGCTCAGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAACGGCGGG
AGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATCTAATTAGTGACGCGCATG
AATGGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGCCAAGGG
AACGGGCTTGGCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTCTGGC
ACGGTGAAGAGACATGAGAGGTGTAGAATAAGTGGGAGGCCCCCGGCGCCCCCCCGTTCC
CCGCGAGGGGTCGGGGCGGGGTCCGCCGGCCTCGCGGGCCGCCGGTGAAATACCACTACT
CTCATCGTTTTTTCACTGACCCGGTGAGGCGGGGGGGCGAGCCCCGAGGGGCTCTCGCTT
CTGGCGCCGAACGCGTCCGCGCGCGCGGGCGGGCGCGACCCGCTCCGGGGACAGTGCCAG
GTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGA
GCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAAAAGCTCGCTTGATCTTGAT
TTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCACGATCCTTCTGACCTTTTGGGTT
TTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCTTGTGGCGGCCAAGCGT
TCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGGCTCTTCCTATCATTGTGAAGCAGA
ATTCACCAAGCGTTGGATTGTTCACCCACTAATAGGGAACGTGAGCTGGGTTTAGACCGT
CGTGAGACAGGTTAGTTTTACCCTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCA
GTACGAGAGGAACCGCAGGTTCAGACATTTGGTGTATGTGCTTGGCTGAGGAGCCAATGG
GGCGAAGCTACCATCTGTGGGATTATGACTGAACGCCTCTAAGTCAGAATCCGCCCAAGC
GGAACGATACGGCAGCGCCGAAGGAGCCTCGGTTGGCCCCGGATAGCCGGCTCCCCGTCC
GTCCCCGTCCGGCGGGTCCCCGCCTCGTCGCCCCCCCGGGTGCGGGGCGGGTCCCCCCGC
CGGGCGTCGGGACCGGGGTCCGGTGCGGAGAGCCATTCGTCCCGGGAAACGGGGTGCGGC
CGGAAAGGGGGCCGCCCTCTCGCCCGTCACGCTTAACGCACGTTCGTGTGGAACTTGGCG
CTAAACCATTCGTAGACGACCTGCTTCTGGGTCGGGGTTTCGTACGTAGCAGAGCAGCTC
CCTCGCTGCGATCTATTGAAAGTCAGCCCTCGACACAAGGGTTTGT
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved