snOPY snoRNA Orthological Gene Database
Rattus_norvegicus
5.8S rRNA
J01881
158
CGACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCGCTAGCTGCG
AGAATTAATGTGAATTGCAGGACACATTGATCATCGACACTTCGAACGCACTTGCGGCCC
CGGGTTCCTCCCGGGGCTACGCCTGTCTGAGCGTCGCT
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved