snOPY snoRNA Orthological Gene Database
Pongo_pygmaeus
28S rRNA
NW_002907982
5411
CGTGACGTCAGATCAGACGTAGTGACCCGCTGAATTTAAGCGTATTAGTGAGCGGAGGAA
AAGAGACTAACCAGGATTCCCTCAGTAACGGTGAGTGAAGAGGGAAGAGCCCAGCGCCAA
ATCCCCGCCCTGTGGTGGGGTGCAGGAAATGTTGTGTATGGAAGGCCCAGTCCCCGGCAC
CGCTCATGGGTGGCCCAAGTCCTGTTCTAGGCCAAGACTGTGGATGTTGTGAGGCTGGTA
GCGGTCCCTGGCGTGCTGGACCCAGGTGTCCTGGAGTTGGGTTGCTTGGGAATGCAGACC
AAAGTGGGTGGTAAACATCTAAGGCTAAATACTGGCATGAGACTTCTAGTGAAGTACCAT
AAGGGAAAGTTGAAAAGAACTTTGAAGAGCGTGCAAGAGGGCGTGAAACCATTAAGAGGT
AAATGGGTAGGGTCCACGCAGTCTGCTCGGAGGATTCAACCCGGCAGTCGATCGAGCCGT
GTCAGTGGCCTGGTGGATCTTTCCCGTCCCCGTTTCTCCCGACACCTCCACCAGCCCTCC
CTCCCCCACTGCCCCTCCTCCTCCCCGGAGGGGCTGGGCTCCGGTGGGTGTGTGGGTGGG
TGGGGCCATGGTCGGTGGGGGACTATCCCCCAGTCGGCGACTGGCGGCCGGCGGGTGCAT
TTCCACTGCGGCAGTGCACTGTGACTGGCTCTGGGATGGTTGGGAAGGCCTGGTGGGGAA
GGGTGGGTCTGGGGGTCCCGTTCGTCCTTCCCCGTCTTCTCCCCGGCCCCGCATCCTCCC
TTGGGAGGCCGTGCGGGTTGGGGTGGCAGCAGTGGTGGGACCGAACCTCCTGAGTTACAG
ACCCCCCACGACAGCCCTTGCCAAATCCCAGGGCTGAGGGAGTGAGACCCATTGCCATGC
TCTCCCCACCAGTGCCCCCCCCGTGGGGGTGCGCCGGTGTCTCCTTGTGGGGGGCCAGGC
CAACCCTCCCAAGGTGTGACTGCTCTCCCACCCCCCTCCCTGCATCCCTGGTGATGGGGG
GCCGAGTAAGGGGGTGGGCCAGACTGTCCCCAGTGTGCCAGGGGTGGGTTGCGCTGTCGG
CCTGGGGGAGTTCTCTCCGGGCCATGCGGACGTCCCTCAGTGGGAGTGAGAACACGGGGT
CGGCGGCAACGTTGGGTCTCCACTGGACACCCGACCCGCCTTGAAACATGGACCAAGGTT
AACACGTGCGTGAGTCAGGGGCTCGCACGAAAGCCGCTGTGGAGCAATGAAGGTGAAGCC
CGGTGTGCTCTCTGGCCGAGGTGGGATCCCGAGGCCTCTCCAGTCTGCTGATGGCGTACC
ACCATCCCGTCTTATCTGCCACGCCAGGGAGGTGGAGCACGAGAGCACGTGTTAGGACCA
GAAAGATGGTGAACTATGCCTGGGCAGGGTGGAGCCAGAGGAAACTCTGGTGGAGGTCCG
TAGCAGCCCTGACATGCAAATTGGTCTTTCGACCTGGGTATAGGGGTGAAAGACTAATCG
AACTATCNNNNNNNNNNTCCCGTTCCTCCTTCCCCGTCTTCTCCCCGGCCCCGCATCCTC
CCTCGGGAGGCCGTGCGGGTCGGGGTGGCAGCAGTGGTGGGACCGAACCTCCTGAGTTAC
AGACCCCCCACGACAGCCCTTGCCAAATCCCAGGGCTGAGGGAGTGAGACCCATTGCCAT
GCTCTCCCCACCAGTGCCCACCCCTGTGGGGGTGCGCCAGTGTCTCCTTGTGGGGGGCCA
GGCCAACCCTCCCAAGGTGTGACTGCTCTCCCACCCCCCTCCCTGCATCCCTGGTGATGG
GGGGCCGAGTAAGGGGGTGGGCCAGACTGTCCCCAGTGTGCCAGGGGTGGGTTGCGCTGT
CGGCCTGGGGGAGTTCTCTCAGGGCCATGCGGACGCCCCTCAGTGGGAGTGAGAACACGG
GGTCGGCGGCAACGTTGGGTCTCCACTGGACACCCGACCCGTCTTGAAACATGGACCAAG
GTTAACACGTGCGTGAGTCAGGGGCTCGCACGAAAGCCGCTGTGGAGCAATGAAGGTGAA
GCCCGGTGTGCTCTCTGGCCGAGGTGGGATCCCGAGGTCTCTCCAGTCTACTGATGGCGT
ACCACCATCCCGTCTTATCTGCCACGCCAGGGAGGTGGAGCACGAGAGCACGTGTTAGGA
CCAGAAAGATGGTGAACTATGCCTGGGCAGGGTGGAGCCAGAGGAAACTCTGGTGGAGGT
CCGTAGCAGCCCTGACATGCAAATTGGTCTTTCGACCTGGGTATAGGGGTGAAAGACTAA
TCGAACTATCTAGTAGCTGTTTCTCTCTGAAGTTTCCCTCAGGATACCTGGTGCTCTAAC
AAACCTAACGTCCCCACGCAGTTTTATCTTTTAAAGCGAATGATTAGAGGTCTTGAGGCT
GAAACGATCTCAACCTATTCTGAAACTTTAAATGTGTAAGAAGGCTGGCTCGCTGGCGTG
GAGCCGGGCATGGAATGCGAGTGCTTAGTGGGCTATTTTTGGCAAGTAGAACTGGCACTG
TGGGATGAACTGAATGCCGGGTTAAGGTGCCTGGTGCCAACACACATCAGATGCCAGAGA
AGGTGTTTGTTGATATACACAGCCGGACGGTGGCCGTGGAAGTTGGAATCCGCTATGGAG
TGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGTGCTGGAGCGTCG
GGCCCATACCCGGCTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGTGC
TGGAGCGTCGGGCCCATACCCGGCTGTTGCCGGCAGTTGAGAGTGGACGGGAGCGGCAGG
GGCGGTATGCCCATGTGAGTGTGGTGGGGGTCCTCTCCTGCCCCCTCCCCAGAGCCCCAT
GGACTCTACGTCGCGACGAGTAGCAGGGCCGCTGCGGTAAGCTTTGAAGCCTAGGGCTTG
GGCCCAGGTGGAGCCGCCACAGGTGCAGATCTTGTTGGTAGTAGCAAATTTTCAAATGAG
AACTTTGAAGGCCGAAGTGGAGAAGAGTTCCACGTGAACAGTAGTTGAACATGGGTCGGT
CAGTCCTGAGAGATTGCTGAGTGCCGTTCCGAAGGGACGGGTGATGGCCTCTGTTGCCCT
CAGCCGATTGAAAGGGGGTCGGGTTTAGATCCCTGAGTCCAGAGTGGCGGAGACGGGCAC
CACGAGACGTCCAGTGCGGTAATATGACCGATCCTGAAGAAGCATGCGGGAGCTCCCGGG
AGGGTCCTCTTTTCTTTATGAAGGACAGGGTGCCCTGGAATGGGTTCACCCTGAGAGAGG
GGCCTGTACCTTGGAAAGCGTCGTGGTTCTGGTGGCATCTGGTGAGCTCTGGCTGGCCCT
TGAAAATCCACGGGAGACAGTGTAAGTCTCGCACGGGCCATACCCATGTCTGCAGCAGGT
CTCCAAGGTGAACAGACTCCGGCATGTTGGAAAAATGTAGGTAAGGGAAGTCAGCCAGCC
AGATCCGTAACTTCGGGATAAATATTGGCTGTAAGAGCTGGGTGCGTGCCGCCACTGGAT
GAAGCGCTGCTGCCCCCCCAACGCCCTGGGCGAGCCTGTCATGGCCCTCCCCTGCCCCAC
CCCACGTGCCGCTCACTCCCTCCCTCGCCCCCTTTCTCCCCGTCCTCCCCCTCCCTGGGG
GTGGCAGTGGTGGTAGGGCCCTGGTGGCGGGGCATGATCTCCCGTGAGGGCGGCCTGGAG
AGCCGGTGTCGGTGGTGACTCTGGACGTGAGTTGGGCCCTTCCCATGGATTGCCCCAGTT
GTGGCCACCCATGTGGAGCCTGGTGGGTGCTGGTGTGGCCTGTCTCGCTCCGTGCCATCG
TGCATATCCGCATGGGCAGGGAGTGATTGGGTGTCGGTGGGTGGTCGGGTGGGGTTGTTT
GTTCCCCCATCTCCCTCTGGCCCAATCCGTCTCCCTTCCCCACCTCCGTGGCAGTGGCGG
GATGTTGGCTGGTCCCTGTCCCCGGGGCCGCGGTTCCGTGCAGTGCCTCGGCCGGTGCTT
AGCAGCCAACTTACAACTGTTGTGCACCAGGGGAATCCGACTGTTTAAACAAAGCATTGC
AAAGGCCCTCGGGGGTGTTGCAAAGTGATTTCTGCCCAGTGCTCTGAATGTCAAAATGAA
GAAATTCAATGAAGCATGGGTAAATGGTGGGAGTAACTGTGACTATCTTAAGGTAGCCAA
ATGCCTCGTCATCTAACTAGTGATGTGCATGAATGGATTAATGAGATTCTCACTGTCCCT
ACCTACTTACTCTCCAGTGAAAAAACAGCCAAGGGAATGGGATTGGTGGACTCAGTGGGG
AAAGAAGACCCTGTCCAGCTTGACTCTAGTGTGGCATGGTGAAGAGATGTGAGAGGTGTA
GAATAAGTGGGAGGTCCCCAGTGCCCCCCTGTCCCCGTGAGGGGGTGGGGTGGGGTCCTG
TGGGCTGCCCATGGAATACTACTACTCTGACCGTTTTTCACTGACCCGGTGAGGCAGGGG
GTGAGCCCCGAGGGGCTCTCCCTTCTGGCGCCAAGTGCCCAGCTGTGCACCAGCCGGATG
TGACCTGTTCCGGGGACAGTGCCAGGTAGGGAGTTTGCAGCGGTAAACCTGTTGAACGGT
AATGCAGGTGTCCTAAGGCGAGCTCAGGGAGGACAGAAATTTCTTAAGGAGAAGAGCAAA
AGCTCGCTTGATATTAACTTTCAGTGCGAATGCAGACTGAAAGCCGGGCTTTGACGATCC
TTCTCACCTTTTTAAGCAGGAGGTTGTCAGGAAGTTACCACAGGGGATAACTGGCTTGTT
GCGGCCAAGTGTTCTTAGGGACGCTGCTTTTTGATCCTTTGATGTTGGCTCTTCCTATCA
TTGTGAAGTAGAATTCACCCAGCATTGGATTGTTCAACTAATAGGGCATGTGAGCTGGAT
TTAGACCATCATGAGACAGGTTAGTTTTACCCTACGTGATGTGTTGCCATGTTACCTACT
CAGCATGAGAGGAACCACAGGTTCAGACATGTGCTTGGTTTAGGAGCCAATGGGGTGAAG
CTACCGTCTGTTGGATTATGACTGAACGCCTCTAAGTCAGAATCCCACCCAAGTGGAAGG
ATACAGCAACACTGTGGAGCCTTGGTTGGCCTTGGATAGCCGGTTCCCCTTCCCTGCTGG
TGGGCTGCCGCACCCTGGGGGGGTGTGCCCCACCGTGTGCCAGGACTGGGTCCAGTGCAG
AGTGCCCTTCATCTTGGGAAGGGTGTGGCCGGAAAGGCGACCTACTCGCCCGTCATGCAA
CACACTTTCGGGGGGAACTTGGCGCTAAACCATTCGTAGACGACCTGCTTCTGGGTCAGA
ATTTCGTAAGTAGCAGAGCATCTCCCTTGCTGTGATCTATTGAAAGTCAGCCCTTGACAC
AAGGGTTTGTC
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved