snOPY snoRNA Orthological Gene Database
Pan_troglodytes
28S rRNA
NC_006492
4549
CGTGACATCAGATCAGACGTGGTGATCCATTGAATTTAAGCGTATTAGTGAGCGGAGGAA
AAGAGACCAACCAGGATTCCCTTAGTAACAGTGAGTGAAGAGGGAAGAGCCCAGTGCTGA
ATCCCTGCCTTGTGGTGGGGTGTGGGAAATGTTGCATATGGAAGGCCCTGTCCCCGGCAC
CGCTGGTGGGTGGCCCAAGTCCTGATCTAGGCCAAGACTGTTGGTGGTGTGAGGCTGGTA
GCCACCCCTGGCGCGCTGGGCCCGGGTCTTCCTGGAGTTGGGTTGCTTGGGAATGCAGAC
CAAAGGGGGTGGTAAACATCTAAGACTAAATACTGACACGAGAGCGATAGTGAAGTACCA
TAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGGGCATGAAACCATTAAGAGGTAAATGGG
TGGGGTCCGAGCAGTCTGCTTGGAGGATTCAACCCGGCTGCTGGTCTGGCCATGTTGGTG
GCCCGGTGGATCTTTTCTGCCCCCTGTTCCTCCTGACCCTCCCACCCGCCCTCCCTCCCC
CACTGCCCCTCCTCCTCCCCGGAGCGGGTGGGCTCCGGTGGGAGTGTGGGCAGGCGGGGC
CGGGATCGGTGGAGGACTGTCCCCCAACTGGCGACTGGCGGCCGCTGGGTGCATTTCCAC
CGCGGCGGTGCACTGTGACTGGCTCTGGGATGGGTGGGAAAGCCCGGTGGGGAAGGGTGG
GTCTGGGGGCCCCTTCTGTCCTTCCCCATCTTCTCCCAGGCTGCGTGTCCTCCCTCGGGA
GGCCGTGCGGGTCGGGGTGGTGGTGGTGGTGGGACCAAATCTCCTGAGTTACAGAACCCC
TGCAGCAGCCATTGTCAAATCCCAGGGCCGAGGGAGAGAGACCCATTGTTGTGCTCTCCC
CTGCCAGTGCCCTCCCCCCTGGGGGTGCGCCGGTGTCTCCTGTTGGGGAGCCGGGACACC
CCTCCCACTGTGTCTGCTCTCTCAACCCCCTACCTGCATCCCCGGTGACGGGGAGCTGTG
TAGGGGGATAGGGCAGACTGTCCCCAGTGTGCCATGGGCGGGTCATGCTGTCGGCCCGGG
GGAGTTCTCTTGGGGCCACGCAGACGTCCCTCGGTGTAGCAAGCACATGGGATCGGTGGT
GACGTCGGCTCCCCACCCGACCCATCTTGAAACACGGACCAAGGTTAACACGTGCATGAG
TCAGGGGCTCGCACGAAAGCCGCTGTGGAGCCATGAAGGTGAAGGCTGGTGTGCTCACTG
GCTGAGGTGGGATCCCGAGGCCTCTCCAGTCTGCCGACAGCGTACCACCATCCCATCTCA
CCTGCCGCGCCAGGGAGGTGGAGCACGAGCGCATGTGTTAGGACCTGAGAGATGGTGAAC
TATGCTTGGACAGGGTGGAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGCCCTGATG
TAGAAATCGGTCTTTCGACTTGGGTATAGGGGTGAAAGACTAATGGAATCATCTAGTAGC
TGGTTCCCTCTGAAGTTTCCCTCAGGATACCTGGTGCTCTCGCAAACGTAACCTCACCAT
GCAGTTTTATCCGGCAAAGCCAATGATTAGAGGTCTTGGGGAGGAAATGATCTCAACCTA
TTCTGAAACTTTAAGTGTGTAAGAAGCCTGGCTCACTGGCATGGAGCCAGGCATGGAATG
AGAGTGCCTAGTGGGCTACTTTTGGTAAGTAGAACTGGCACTGTGGGATGAACCGAATGC
CGGGTTAAGGTGCCCAAAGCCAACAGTCATCAGACCCCAGAAAACGTGTTGGTTGATATA
GACAGCAGGACGGTGGCCATGGAAGTTGGAATCTGCTAAGGATTGTGTAATAACTTACCT
GCCAAATCAACTAGCCCTGAAAATGGATGGTGCTGGAGCGTCGGGCCCATACACGGCTGT
TGCTGGCAGTTGAGAGTGGACGGGAGCGGTGGTGGCAGTATGCCCGTGTGAGTGTGGTGG
GGGTCCTCTCCTCCCACCTCCCCTGGAGCCCCAGGGACTCTACGCCATGACGAGTAGGAG
GGCCGCTGCAGTAAGTTTTGAAGCCTAGGGCGTGGGCCTGGGTGGAGCCGCCACAGGTGC
AGATCTTGGTTGTAGTACCAAATTTTCAAATGAGAACTTTGAAGGCCAAAGTGGAGAAGG
GTTCCATGTGAACAGCAGTTGAACATAGGTCGGTCGGTCCTGAGAGATGGGTGAGTGTCG
TCCCGAAGGGAAGGGTGATGGCCTCCATTGCCCTCAGCCGATTGAAAGGGAGTCGGGTTC
AGATCCCTGAATCCAGAGTGGTGGAGATGGGCACCACGAGGCGTCCAGTGTGGTAATATA
ACCGATCCTGGAGAAGCATGTGGGTGCCCCAGGGAGGGTTCTCTTTTCTTTGTGAAGGAC
AGGGCACCTGGAGTGGCATTGCCCTGAGAGAGGGACCTGTACCTTGCAAAGCATCGTGGT
TCTGCTGGTGTCTGGTGAGCTCTGGCTGGCCCTTGAAAATCCAGGGGAGACGGTGTAAGT
CTCACACAGGGCCATACCCATGTCTACAGCAGGTCTCCAAGGTGAACAGACTCTGGCCTG
TTGGAACAATGTAGGTAAAAGTAGTCAGCAAGCCAGATCCATAACTTTGGGATAAGTATT
GGCTGTAAGGGCTGGGTGCGTGCCGCCGCTGGACGAGGTGCTGCCGCCTCCCCACTACCC
GGGCGAGCCTGTCGTGGCCCTCCCCTGCCCCACCCCATGTGCCGCTCGCTCCCTCCACTG
CCCCCTCTCTCCCCATCCTCCCCCTCCCTGGGGGTGGCAGTGGCCATAGGGCACTGGTGG
CAGGGTATGATCTCCTGTGAGGGGGGCCTGGGAGGCTAGTGTCGGTGGTGACTCTGGACG
CAAGTTGGGCCCTTCCCATGGATTGCCCCAGTTGTGGCCGCCCATGGGGAGTCAGGTGGG
TGCTGGTGTGCCCTGTCTTGCTCTGTGCCATGGTGCATGTCCACTCAGGCAGGGAGCGAT
CTGGTGTTGGTGGGTGGTGGGTGGTGTGTGGGGTGGTTCGTTCCCCCACCTCCCCCCGGC
CCCATCTGTCTCCCGTCCCCCACCCCGTGGTGGTGGCGGGCTACTGGCTGGTTCCTATCC
CCAGGACCATCGTTCTGTGCAGTGCCTCGGCTGGTGCTTAGCAGCCAACTTAGAGCTGGT
GTGCACCAGGGGAACCCGACCATTTAAAGAAAGCATCGCGAAGGCCCTCAGGGAGTGTTG
TGAAATGATTTCTGCCCAGTGCTCTGAATGTCAAAATGAAGAAATTCAATGAAGCACGGG
TAAATGGCAGGAGTAACTGACTCTCTTAAGGTAGCCAAATGTCCCGTCAACTAACTAGTG
ATGTACATGAACGGATGAACGAGATTCTCACTGTCCCTACCTACTTGCTCTCCAGTGAAA
CAACAGCCAAGGGAATGGGATTGGTGGAATCAGTGGGGAATGAAGACTCTGTTGAGCTGG
CTCTAGTCTGGCATGGTGAAGAGATGGGAGAGGTGTAGAATAAGTGGGAGGTCTCCGGTG
CCCCCCTGTCCCCGTGAGGGGGCAGGGTGGGTTCCTGTGGGCTGCCCGTGGACTATTAAT
ACTCTGATCCTTTTTTCACTGACACGGTGAGGCAGGGGGTGAGGCCCAAGGGGCTCTGCC
TTCTGGTGCCAAGTGCCCAGCTGTGCGCCGGCCGGGTGTGATCCATTCCAGGGACAGTGC
CAGGTGGGGAGTTTGTGGCAGTACGCCTGTCGAACGGTAATGCAGATGTCCTAAGACGAG
TTCAGGGAGGACAGAAACTTCTTGAGGAGAAGGGCAAAAGCTCGCTTGATCTTGATTTTC
AGTGCGAATACAGACTGAAAGCTGGGCTTTGATGCTCCTTCTGATCCTTTTAAGCAGGAG
ATTGTCAGGAAGTTACCATGGGGATAACTGGCTTGTTGCAGCCAAGTGTTCATAGAGACG
TTGCTTTTTGATCATTTGATGTTGGCTCTTCCTATCATTGTGAGGTAGAATTCACCCAGC
ATTGGATTGTTCAACTAATAGGGCATGTGAGCTGGATTTAGACCGTCGTGAAACAGGTTA
GTTTTACCCTGTGTGATGTGTTGCCATGGTACCTGCTCAGCATGAGAGGAACCGCAGGTT
TAGACATATGCTTGTTTGAGGAGCCAATAGGGTGAAGCTACCATCTTTTGGATTATGACT
GAATGCCTCTAAGTCAGAATCCCACCCAGGTGGAAGGATACAGCAATGTTGTGGAGCCTT
GGTTGGCCTTGGACAGCTGGTTCTCCATCCCTGCTGGTAGGCTGCAGAGCCCTGGGTTGG
GTGTGTCCCACCATGTGCCTGGACTGGGTCCGGTGCAGAGTGCTCTTCATCCTGGGAAGG
GTGTGGCTGGAAAGGCGACCTACTCGCCCTTCATGCAACACACATTCGGAGGGAACTTGG
TGCTAAACCATTCGTAGACGACTTGCTTCCAGGTCGGAGTTTCATAAGTAGCAGGGCAGC
TCCCTTGCTGTGATCTATTGAAAGTCAGCCCTTGACACAAGGGTTTGTC
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved