snOPY snoRNA Orthological Gene Database
Otolemur_garnettii
5.8S rRNA
159
CAACTCTTAGTGGTGGATCACTAGGCTCATGTATCAACGAAGAATGCAGCTAACTGCAAG
AATTTGAATTTTCAGGACACATTGATTGTTGGCACTTTAAGTGCACTTTTGGCCCTGGAT
TCCTCCTATGTCTGAGTGTTCCTTGATGAGCAATTGCCC
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved