snOPY snoRNA Orthological Gene Database
Oryzias_latipes
5.8S rRNA
158
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCTAGCTGCGAG
AACTAATGTGAATTGCAGGACACATTGATCATCGACACTTCGAACGCACCTTGCGGCCCC
GGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGTTT
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved