snOPY snoRNA Orthological Gene Database
Oryctolagus_cuniculus
28S rRNA
NW_003159740
4845
CGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTCAGCGGAGGAA
AAGAAACTAACCAGGATTCCCTCAGTAACGGCGAGTGAACAGGGAAGAGCCCAGCGCCGA
ATCCCCGCCCCGCGGTGGGGCGCGGGAAATGTGGCGTACGGAAGACCCACTCCCCGGCGC
CGCTCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCCAGCCCGTGGACGGTGTGAGGCCG
GTAGCGGCCCCCGGCGCGCCGGGCCCGGGTCTTCCCGGAGTCGGGTTGCTTGGGAATGCA
GCCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGTCAA
CAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAA
CCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCCGCCCGGAGGATTCAACCCGGCGGC
GTGGTCCGGCCGTGCCGGCGGTCTCGGCGGATCTTTCCCGCTCCCCGTTCCTCCCGACCC
CTCCACCCGCTCCCCCTCCCCCGCCGGTCTTCTCCCTTCACGGGGGGTGGGTCGGCGGGT
GCGGGGGTGGGCGGGCGGGGCCGGGGGTGGGGTCGGCGGGGGACCGCCCCCCGGCCGGCG
ACCGGCCGCCGCCGGGCGCATTTCCACCGCGGCGGTGCGCCGCGACCGGCTCCGGGACGG
CTGGGAAGGCCCCGGCGGGGAAGGTGGCCCGGGGGGACGCCTCGCCGCCGTCGTCCGCGG
CGGCGGCGGGCGCGACCCCTCCCCGGGTGTTACAGCCCCGCCCCGGCAGCAGCAGGTCGC
CGAATCCCGGGGCCGAGGGAGCGAGACCTGTGTCGCCGCGCTCTCCCCCCTCCCGGCGCT
CCCCCCCGCGGGGGTCCCCCGCGAGGGGGCTCCCCCCGCGGGGGCGCGCCGGTGTCGCCG
CCCTCGCGGGCGCGGCACGGGGGAGGCCGGGTCGTCGCCTGCTTTAAGAGACCTTTTTTA
CTGCTCCCGCCACTGCCTTCCGGGGGTTTGTTAGTATTTCGTTGAAATGTTGATATTAAG
CAAAATGTGTTTATTATTTTTTTTCCGCTTTTCTTTTAAGTCTTATTCACCCCTTTTATG
TTACTCCCCCCTTCCCCTCCTTCTCCTTTTTTTTAGGTACGAGAAGAAATATCATTATAC
CCTATGGTCTCTAGCTTTNNNNNNNNNNNNNNNNNNNNNNCGGACCACCCCCGATTTCTC
CCGCCCTGGCGGGACGCGGCTCAGGGGGCAGGAGCTCCCCCTTCCCAGAGCGCGACCGCT
CTCCCGGCCCCCGCCGCCGCTCTCCCGGGCGTGTGGCGGGGGTGGGGCGGACTGTCCCCA
GTGCGCCCCGGGCGTGTCACGCCGTCGGGCTCGGGGGAGAAGTCGGCCACGGCGCGTCGC
GCGCCTCCGCGTCCCCCCCTCGCCGTCTCCGGGCGGCGGGGGGGGGGTTTCGGCGCGGTG
TTCTCGGCGCGCGCGCGCGAGCGAGCGCACGGGGTCGGCGGCGATGTCGGCTACCCACCC
GACCCGTCTTGAAACACGGACCAAGGAGTCTAACACGTGCGCGAGTCGGGGGCTCGCACG
AAAGCCGCCGTGGCGCAATGAAGGTGAAGAAGGCGGGAAGCCGCCGCCGGCCGAGGTGGG
ATCCCGAGGCCCTTCCAGTCCGCCGAGGGCGCACCACCGGCCCGTCTCGCCCGCCGCGCC
GGGGAGGTGGAGCACGAGCGCACGTGTTAGGACCCGAAAGATGGTGAACTATGCCTGGGC
AGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCTGACGTGCAAATCGGT
CGTCCGACCTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCC
GAAGTTTCCCTCAGGATAGCTGGCGCTCTCGCAACCCCGCAGTTTTATCCGGTAAAGCGA
ATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAA
GAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTT
TGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCG
ACGCTCATCAGACCCCAGAAAAGGTGTTGGTTGATATAGACAGCAGGACGGTGGCCATGG
AAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAA
TGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCTGGCAGTCGGCAGAGCGAGA
AAGAGAGTGGAGCGCGCCGCGGGACTCCCCCCGCGGGGGGCCACCCCCCCCCCCCCGCGG
ACGCTACGCGCGACGAGTAGGAGGGCCGCTGCGGTGAGCCTTGAAGCCTAGGGCGCGGGC
CCGGGTGGAGCCGCCGCAGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAAC
TTTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGG
TCCTGAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGATGGCCTCCGTTGCCCTCAG
CCGATCGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGC
GAGGCGTCCAGTGCGGTAACGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGA
GTTCTCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAGAGGGGC
CCGTGCCTTGGAAAGCGTCGCGGTTCCGGCGGCGTCCGGTGAGCTCTCGCTGGCCCTTGA
AAATCCGGGGGAGAGGGTGTAAATCTCGCGCCGGGCCGTACCCATATCCGCAGCAGGTCT
CCAAGGTGAACAGCCTCTGGCATGTTGGAACAATGTAGGTAAGGGAAGTCGGCAAGCCGG
ATCCGTAACTTCGGGATAAGGATTGGCTCTAAGGGCTGGGTCGGTCGGGCTGGGGCGCGA
AGCGGGGCTGGGCGCGCGCCGCGGCTGGACGAGGCGCCGCCGCCCCCCCCACGCCCGGGG
CGCCCTCCCCCGGCGGCTCCCTCGCCTCACCTGCACCTCCTTGATGGCCCTGCTTCCCTG
GCCTTCCTGGCAAACTCTCCTGGTTCCTCACTCCTGTCCTTCCTTCTGGCTTCTCACTGG
CACTTGGGCTCCTGTCATACATCTGTACCATGACCTGAGACAGAAATTGGAAATGTACTA
AAGGTCCTCTCGCACACAGAACAGCCTAGGACTACAAGAATACACTGCCTAAATTCTAGC
NNNNNNNNNNNNNNNNNNNNNNGTATAGACACATATATCTAGGTGCACGCGAGCGAGCGC
ACGGGGTCGGCGGCGATGTCGGCTACCCACCCGACCCGTCTTGAAACACGGACCAAGGAG
TCTAACACGTGCGCGAGTCGGGGGCTCGCACGAAAGCCGCCGTGGCGCAATGAAGGTGAA
GGCCGGCGGCGGCTTCCCGCCGTCGTCGGCCGAGGTGGGATCCCGAGGCCCTTCCAGTCC
GCCGAGGGCGCACCACCGGCCCGTCTCGCCCGCCGCGCCGGGGAGGTGGAGCACGAGCGC
ACGTGTTAGGACCCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACT
CTGGTGGAGGTCCGTAGCGGTCCTGACGTGCAAATCGGTCGTCCGACCTGGGTATAGGGG
CGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCTCAGGATAGCT
GGCGCTCTCGCAACCCCGCAGTTTTATCCGGTAAAGCGAATGATTAGAGGTCTTGGGGCC
GAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTAAGAAGCCCGGCTCGCTGGCGTG
GAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTG
CGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAGACCCCAGAAA
AGGTGTTGGTTGATATAGACAGCAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAG
TGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAAAATGGATGGCGCTGGAGCGTCG
GGCCCATACCCGGCCGTCGCTGGCAGTCAGCAGAGCGAGAAAGAGAGTGGAGCGCGCCGC
GGGACTCCCCCCGCGGGGGTCCCCGGCCACCCCCCCCGCGGACGCTACGCCGCGACAAGT
AGGAGGGCCGCTGCGGTGAGCCTTGAAGCCTAGGGCGCGGGCCCGGGTGGAGCCGCCGCA
GGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGA
GAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAG
CGCCGTTCCGAAGGGACGGGCGATGGCCTCCGTTGCCCTCAGCCGATCGAAAGGGAGTCG
GGTTCAGATCCCGAATCCGGAGTGGCAGAGATGGGCGCCGCGAGGCGTCCAGTGCGGTAA
CGCGACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAGTTCTCTTTTCTTTGTGAA
GGGCAGGGCGCCCTAGAATGGGTTCGCCCCGAGAGAGGGGCCCGTGCCTTGGAAAGCGTC
GCGGTTGCAGCGGCGTCCGGTGAGCTCTCCCTGGCCCTTGAAAATCCGGGGGAGAGGGTG
TAAATCTCGCGCCGGGCCGTACCCATATCCGCAGCAGGTCTCCAA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved