snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus
5.8S rRNA
153
GACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCTAGCTGCGAGA
ATTAATGTGAATTGCAGGACACATTGATCATCGACACTTCGAACGCACTTGCGGCCCCGG
GTTCCTCCCGGGGCTACGCCTGTCTGAGCGTCG
SNORA69 18S:U33,5.8S:U68 H/ACA
SNORD71 5.8S:U13 C/D
SNORA72 5.8S:U54 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved