snOPY snoRNA Orthological Gene Database
Ornithorhynchus_anatinus
28S rRNA
AAPN01386684
1735
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTTGAACCTCGGTTCTAGTATCCTGATCGCTCATCTAAACGACCGAACTGGAACCGGTAC
GGACTCAGGGAATCCGACTGTCTAATTAAAACAGAGGTGACAGATGGTCCTCGCGGACGT
TGACTGTCACTGATTTCTGCCCAGTGCTCTGAATGTTAAATCGTAGTAATTCGAGTAAGC
GCGGGTAAACGGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTCATTTA
ATTGTTGACGCGCATGAATGGATTAACGAGATTCCTACTGTCCCTAACTACTATCTAGCG
AAACCACAGCCAAGGGAACGGGCTTGGCAAAAATAGCGGGGAAAGAAGACCCTGTTGAGC
TTGACTCTAGTTTGACATTGTGAAGAGTCATGAGAGGTGTAGCATAGGTGGGAGACTTCG
GTCGCCAGTGAAATACCACCACTTTCATCGACTCTTTACTTATTCGGTTAAAAGAGAATT
GGCCTCACGGCCTTTTTTCGAAGCTTTAAGCGGAGCCATTTTATGGCACCGTGACTCTCC
TCGAAGACAGTGTCAAGCGGGGAGTTTGACTGGGGCGGTACATCTATCAAATCGTAACGT
AGGTGTCCTAAGGCGAGCTCAGAGAGGACGGAAACCTCTCGTAGAGCAAAAGGGCAAAAG
CTTGCTTGATCTTGACTTTCAGTACGAGTACAGACCGCGAAAGCGTGGCCTATCGATCCT
TTTAATCCTGATTGTTTCAGGTAAGAGGTGTCAGAAAAGTTACCACAGGGATAACTGGCT
TGTGGCAGCCAAGCGTCCATAGCGACGTTGCTTTTTGATCCTTCGATGTCGGCTCTTCCT
ATCATTGCGAAGCAGAATTCGCCAAGCGTTGGATTGTTCACCCACTAATAGGGAACGTGA
GCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGTTGACTTGTTATTGCG
AAAGTAATCCTGCTTAGTACGAGAGGAACAGCGGGTTCAAACATTTGGTTCATAGACTTG
ATCGACAGATCAATGGTCTGAAGCTACCATTTGAGAGATTATAACTGAACGCCTCTAAGT
TAGAATCTCGCCTTGTCAAGGCGAAAATTTCTTGCTTCCCGATGTCGGGAGGCATCTCTA
TCTCGTGGCAACACGAGAGCTTATGCCCTATGTATGGCCTTGGCGTCGTAGTGAACTCTG
CGACGCTTGCCAACGCCAGATCACTCTGGTTCAATGTCGGGGCGCTAAATCACTTGCATA
CGACTTGGTCTCTTGGTCAAGGTGTTGTATTCAGTAGAGCAGTCTTCTTATACTGCGATC
TGTTGAGACTATCCTTTGATTGAGTTTTTTGTTGCCCTTTTTCAAAAGGTTTTTTATGTG
AGTTGAGTCAACTCACAAATCCCAAACTTGGGTTTTCGGCGCCGGTTTGGGCGCGCGCAG
CGCGCCCGGCCGGGCTCATAAATAGCATGTTTTTGCAAAAATTGGAGGGTTCTATCCCTG
ATCTGCTGAGACTATCCCTGGGTTGGGTTCGATTTTTGCCACCCCATTTTTTACCCCGCT
TAGTCCCAAGTACTATCACTTTTGATGATAGTTATTTCCCCTCAGTCGGAATAATNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved