snOPY snoRNA Orthological Gene Database
Myotis_lucifugus
28S rRNA
NW_005871925
4373
CGCGACCTCAGATCAGACGTGGCGACCCGCTGAATTTAAGCATATTAGTCAGCGGAGGAA
AAGAAACTAACCAGGATTCCCTCAGTAACGGCGAGTGAACAGGGAAGAGCCCAGCGCCGA
ATCCCCGCCCCGCGGTGGGGCGCGGGAAATGTGGCGTACGGAAGACCCACTCCCCGGCGC
CGCTCGTGGGGGGCCCAAGTCCTTCTGATCGAGGCCCAGCCCGTGGACGGTGTGAGGCCG
GTAGCGGCCCCCGGCGCGCCGGGCCCGGGTCTTCCCGGAGTCGGGTTGCTTGGGAATGCA
GCCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGCCAA
CAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAA
CCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCCGCCCGGAGGATTCAACCCGGCGGC
GTGGTCCGGCCGTGCCGGCGGCCCTGGCGGATCTTTCCCGCGCCCCGTTCCTCCCGACCC
CTCCACCCGTCCTCCTTCCCCCGGTCCCTTCGGGGGCCGGGTGCGTGGGGAGTCGGTGAG
AACCGGGGTGAGGTCTGCGGTGGACCGACCCCCGGCCGGCGACCGGCCGCCGCCGGGCGC
ATTTCCACCGAGGCGGTGCGCCGCGACCGGCTCCGGGACGGCTGGGAAGGCCCGGCGGGG
AAGGTGGCTCGGGGGAGGGCCCCGCTCCCTCGGGGGCGGGGGGCCCACTCTCTCCGAGTG
TTACAGCACCCTGGGAGCAGCGCTCGCCCGAATCCGAGGCCGAGGGAGACATGAACACGT
CGTCACATAGCCTCACTCCCGGGAGCTCACCCCCGGAGCGAGGATGTCCCTTTTTCCTCA
AGAGAGCGGTATAACAACATCTAGGGCCTCCCAGCGCNNNNNNNNNNNNNNNTAATATTT
AATTAGCTGGAATGGTTTGTAGGCGATCCCTGTAAATAGAATCGTTATACCGCCCATAGG
GGTCGTGACCCACCGGGTCGCCACCCCTTGCTCACAGTCCAAGCGGGACTTTCGAGCAGG
AGGACAGAACTGTTCCCAGTGCGCCCCGAGCGAAGTCGCGCCGTCGGGCCCGGGGGGTGA
AGGCGCCACGCCGCGGAGCGAAGCGAGCGCACGGGGTCGGCGGCGATGTCGGCCACCCAC
CCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACACGTGCGCGAGTCAGGGGCTCGCA
CGAAAGCCGCCGTGGCGCAATGAAGGTGAAGGCCCGCCAGGGCCGAGGTGGGATCCCGAG
GCCTCTCCAGTCCGCCGAGGGCGCACCACCGGCCCGTCTCGCCCGCCGCGCCGGGGAGGT
GGAGCAAGAGCGCACGTGTTAGGACCCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAA
GCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCTGACGTGCAAATCGGTCGTCCGAC
CTGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTC
CCTCAGGATAGCTGGCGCTCTCGCAGACACCAACGCAACGCAGTTTTATCCGGTAAAGCG
AATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTAAATGGGTA
AGAAGCCCGGCTCGCTGGCGTGGAGCCGGGCGTGGAATGCGAGTGCCTAGTGGGCCACTT
TTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCC
GACGCTCATCAGACCCCAGAAAAGGTGTTGGTTGATATAGACAGCAGGACGGTGGCCATG
GAAGTCGGAATCCGCTAAGGAGTGTGTAACAACTCACCTGCCGAATCAACTAGCCCTGAA
AATGGATGGCGCTGGAGCGTCGGGCCCATACCCGGCCGTCGCTGGCGGTCGGTCGGAGAC
AGGGGGACGGGAGCACACCGGGCGGCGCTCCGGCGCTCGCCCGGCCCACACCCGCGCCAC
GCTACGCCGCGACGAGTAGGAGGGCCGCTGCGGTGAGCCTTGAAGCCTAGGGCGCGGGCC
CGGGTGGAGCCGCCGCAGGTGCAGATCTTGGTGGTAGTAGCAAATATTCAAACGAGAACT
TTGAAGGCCGAAGTGGAGAAGGGTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGT
CCTGAGAGATGGGCGAGCGCCGTTCCGAAGGGACGGGCGATGGCCTCCGTTGCCCTCAGC
CGATCGAAAGGGAGTCGGGTTCAGATCCCCGAATCCGGAGTGGCGGAGACGGGCGCCGCG
AGGCGTCCAGTGCGGTAACGCAACCGATCCCGGAGAAGCCGGCGGGAGCCCCGGGGAGAG
TTCTCTTTTCTTTGTGAAGGGCAGGGCGCCCTGGAATGGGTTCGCCCCGAGAGAGGGGCC
CGTGCCTTGGAAAGCGTCGCGGTTCCGGCGGCGTCCCGGTGAGCTCTCGCTGGCCCTTTA
AATCCGGGGGAGAGGGTGTCAATCTCGCGCCGGGCCGTACCCATATCCGCAGCAGGTCTC
CCAAGGTGAACAGCCTCTGGCATGTTGGAACAATGTAGGTAAGGAAGTCGGCAAGCGGGA
TCCGTAACTTCGGGATAAGGATGGCTNNNNNNNNNNNNNNNNNNNNNNNNCGGACACCCG
GGGGGCCGGCAGCAGCGTCGACTCTGGACTCCGAGCCGGGCCCTTCCTGTGGATTGCCCC
AGCTGCGGCTGGCATCGCAGCCGCCCTCGGGGAGCCCAACGGGCGGGCAGGTCGCGCAGG
CCCTGGCTGCGCGCTCTGGTCTCTCCCCCGCCGGGCCCGCCCCCGGGGCCGCGGTTCCAC
GCGGTGCCTGGCCTTGGCCGGCGCCTAGCAGCCGACTTAGAACTGGTCCTCACCAGGGGA
ATCCGACTGTTTAATTAAAACAAAGCATCGCGAAGGCCCGCGGCGGGTGGTGACGCGATG
TGATTTCTGCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAAAC
GGCGGGAGTAACTATGACTCTCTTAAGGTAGCCAAATGCCTCGTTATCTAATTAGTGACG
CGCATGAATGGATGAACGAGATTCCCACTGTCCCTACCTACTATCCAGCGAAACCACAGC
CAAGGGAACGGGCTTGGCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCCCG
GTCTAGTACGGTGAAGAGACATGAGAGGTGTAGAATAAGTGGGAGGCCCCCGGCGCCCCT
TCCCTGAGTCCCCGCGAGGGGGCGGGGAGGGGGGTACGCCGGCCTTGCGGGCCGCCGGTG
AAATACCACTACTCTGATCGTTTTTTCACTGACCCGGTGAGGCGGGGGGGCGAGCCCCGA
GGGGCTCTCGCTTCTGGCGCCAAGCGCCCGGCCGGCCGCGCGCCGCGCCGGGCGCGACCC
GCTCCGGGGACAGTGCCAGGTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAACGGTAA
CGCAGGTGTCCTAAGGCGAGCTCAGGGAGGACAGAAACCTCCCGTGGAGCAGAAGGGCAA
AAGCTCGCTTGATCTTGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCACGAT
CCTTCTGACCTTTTGGGTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTG
GCTTGTGGCGGCCAAGCGTTCATAGCGACGTCGCTTTTTGATCCTTCGATGTCGGCTCTT
CCTATCATTGTGAAGCAGAATTCACCAAGCGTTGGATTGTTCACCCACTAATAGGGAACG
TGAGCTGGGTTTAGACCGTCGTGAGACAGGTTAGTTTTACCCTACTGATGATGTGTTGTT
GCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGGTTCAGACATTTGGTGTATGTGC
TTGGCTGAGGAGCCAATGGGGCTGAGGAGCCAATGTGGGATTATGACTGAACGCCTCTAA
GTCAGAATCCGCCCAGGCGGAACGATACGGCAGCGCCGCGGGAGCCTCGGTTGGCCTCGG
ATAGCCGGTCCCCCGCTCGTCCCCGCCGGCGGGCCGTCGCGCCCCCCGCGGGCGCGGCGA
TCCCCCGCCGCGCGTCGGGACCGGGGTCCGGTGCGGAGAGCCCTTCGTCCTGGGACACGG
GGTGCGGCCGGAAAGGGGGCCGCCCCCACGCCCTTCACGCAACGCACGTTCGTGGGGAAC
CTGGCGCTAAACCATTCGTAGACGACCTGCTTCTGGGTCGGGGTTTCGTACGTAGCAGAG
CAGCTCCCTCGCTGCGATCTATTGAAAGTCAGCCCTCGACACAAGGGTTTGTC
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved