snOPY snoRNA Orthological Gene Database
Myotis_lucifugus
18S rRNA
AAPE02056272
1873
TACCTGGTTGATCCTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTA
AGTACGCAAGGCCGGTACAGTGAAACTGCGAATGGCTCAATAAATCAGTTATGGTTCCTT
TGGTCGCTCGCTCCTCTCCTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCCG
ACGGGCGCTGACCCCCCTCGCGGGGGGGATGCGTGCATTTATCAGATCAAAACCAACCCG
GTCAGCCTCCCCTCGGCCCCTCGCGGGCCGTGGGGCGGGCGCCGGCGGCTTTGGTGACTC
TAGATAACCTCGGGCCGATCGCACGCCCCCCGTGGCGGCGACGACCCATTCGAACGTCTG
CCCTATCAACTTTCGATGGTAGTTGCGGTGCCTACCATGGTGACCACGGGTGATGGAGAA
TCAGGGTTCGATTCTGGAGAGGGAGCCTGAAAAACGGCTACCACATCCAAGGAAGGCAGC
AGGCGCGCAAATTACCCACTCCCGACCCCGGGAGGTAGTGACGAAAAATAATACAGGACT
CTTTGAGGCCCTGTAATTGGAATGAGTCCACTTTAAATCCTTTAACGAGGATCCATTGGA
GGGCAAGTCTGGTGCCAGCAGCCTCGGTAATTCCAGCTCCAATAGCATATATTAAAGTTG
CTACAGTTAAAAAGCTCGTCGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCTGCGAGGCG
AGCCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCCCTCGATGCTCTTAGCTGAGTG
TCCCGCGGGGCCCGAAGCGTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCCGAGC
CGCCTGGATACCGCAGCTAGGAATAATGGAATAGGACCGGGGTTCTATTTTGTTGGTTTT
CGGAACTGCCATGATTAAGAGGGACGGCTGGGGGCATTCGTATTGCGCCGCTAGAGGTGA
AATTCTTGGACCGGCTCAAGACGGACCAGAGCGAAAGCATTTGCCAAGAATGTTTTCATT
AATCAAGAACGAAAGTCGGAGGTTCGAAGACGATCAGATACCGTCGTAGCCCCGACCATA
AACGATGCCGACTGGCCATGGCGATGTGGAGGCCTTATTCCCATGACCCGCCGGGCAGCT
TCCGGGAAACCAAAGTCTTTGGGTTCCGGGGGGAGTATGGTTGCAAAGCTGAAACTTAAA
GGAATTGACGGAAGGGCACCACCAGGAGTGGAACCTGCGGCTTAATTTGACTCAACACGG
GAAACCTCACCCGGTCTGGACACGGATAGGATTGACAGATTGAGAGCTCTTTCTGGATTC
CGTGGGTGGTGGTGCATGGCCATTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGA
TAACGAACGAGACTCTGGCATGCTAAATAGTTACGTGACCCCCGAGCGGTCGGCGTCCCC
CAACTTCTTAGAGGGACAAGTGGCGTTCAGCCACCCGAGATTGAGCAATAACAGGTCTGT
GATGCCCTTAGATGTCCAGGGCTGCAAGCGCGCTACACTGACTGGCTCAGCATGTGCCTA
CCCTACGCCCGCAGGCACGGGTAATCCATTGAACCCCATTCGTGATGGGGATCAGGGATT
GCAATTATTCCCCATGAACGAGGAATTCCCAGTAAGTGCGGGTCATAAGCTTGCGTTGAT
TAAGTCCCTGGCCTTTGTACACACCGCCCGTCGCTACTACCGATTGGATGGTTTAATTAG
GCCCTCGGATCGGCCCCTCCGGGGTCGGCCTACGGCCCTGGCGGAGCGCTGAGAAGATGG
TCGAACTTGACTATCTAGAGGAAGTAAAAGTCGTAACAAGGTTTCTGTAGGTGAACCTGC
GGAAGGATCATTA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved