snOPY snoRNA Orthological Gene Database
Myotis_lucifugus
18S rRNA
AAPE02056272
1873
TACCTGGTTGATCCTGCCAGTAGCATATGCTTGTCTCAAAGATTAAGCCATGCATGTCTA
AGTACGCAAGGCCGGTACAGTGAAACTGCGAATGGCTCAATAAATCAGTTATGGTTCCTT
TGGTCGCTCGCTCCTCTCCTACTTGGATAACTGTGGTAATTCTAGAGCTAATACATGCCG
ACGGGCGCTGACCCCCCTCGCGGGGGGGATGCGTGCATTTATCAGATCAAAACCAACCCG
GTCAGCCTCCCCTCGGCCCCTCGCGGGCCGTGGGGCGGGCGCCGGCGGCTTTGGTGACTC
TAGATAACCTCGGGCCGATCGCACGCCCCCCGTGGCGGCGACGACCCATTCGAACGTCTG
CCCTATCAACTTTCGATGGTAGTTGCGGTGCCTACCATGGTGACCACGGGTGATGGAGAA
TCAGGGTTCGATTCTGGAGAGGGAGCCTGAAAAACGGCTACCACATCCAAGGAAGGCAGC
AGGCGCGCAAATTACCCACTCCCGACCCCGGGAGGTAGTGACGAAAAATAATACAGGACT
CTTTGAGGCCCTGTAATTGGAATGAGTCCACTTTAAATCCTTTAACGAGGATCCATTGGA
GGGCAAGTCTGGTGCCAGCAGCCTCGGTAATTCCAGCTCCAATAGCATATATTAAAGTTG
CTACAGTTAAAAAGCTCGTCGTTGGATCTTGGGAGCGGGCGGGCGGTCCGCTGCGAGGCG
AGCCACCGCCCGTCCCCGCCCCTTGCCTCTCGGCGCCCCCTCGATGCTCTTAGCTGAGTG
TCCCGCGGGGCCCGAAGCGTTTACTTTGAAAAAATTAGAGTGTTCAAAGCAGGCCCGAGC
CGCCTGGATACCGCAGCTAGGAATAATGGAATAGGACCGGGGTTCTATTTTGTTGGTTTT
CGGAACTGCCATGATTAAGAGGGACGGCTGGGGGCATTCGTATTGCGCCGCTAGAGGTGA
AATTCTTGGACCGGCTCAAGACGGACCAGAGCGAAAGCATTTGCCAAGAATGTTTTCATT
AATCAAGAACGAAAGTCGGAGGTTCGAAGACGATCAGATACCGTCGTAGCCCCGACCATA
AACGATGCCGACTGGCCATGGCGATGTGGAGGCCTTATTCCCATGACCCGCCGGGCAGCT
TCCGGGAAACCAAAGTCTTTGGGTTCCGGGGGGAGTATGGTTGCAAAGCTGAAACTTAAA
GGAATTGACGGAAGGGCACCACCAGGAGTGGAACCTGCGGCTTAATTTGACTCAACACGG
GAAACCTCACCCGGTCTGGACACGGATAGGATTGACAGATTGAGAGCTCTTTCTGGATTC
CGTGGGTGGTGGTGCATGGCCATTCTTAGTTGGTGGAGCGATTTGTCTGGTTAATTCCGA
TAACGAACGAGACTCTGGCATGCTAAATAGTTACGTGACCCCCGAGCGGTCGGCGTCCCC
CAACTTCTTAGAGGGACAAGTGGCGTTCAGCCACCCGAGATTGAGCAATAACAGGTCTGT
GATGCCCTTAGATGTCCAGGGCTGCAAGCGCGCTACACTGACTGGCTCAGCATGTGCCTA
CCCTACGCCCGCAGGCACGGGTAATCCATTGAACCCCATTCGTGATGGGGATCAGGGATT
GCAATTATTCCCCATGAACGAGGAATTCCCAGTAAGTGCGGGTCATAAGCTTGCGTTGAT
TAAGTCCCTGGCCTTTGTACACACCGCCCGTCGCTACTACCGATTGGATGGTTTAATTAG
GCCCTCGGATCGGCCCCTCCGGGGTCGGCCTACGGCCCTGGCGGAGCGCTGAGAAGATGG
TCGAACTTGACTATCTAGAGGAAGTAAAAGTCGTAACAAGGTTTCTGTAGGTGAACCTGC
GGAAGGATCATTA
SNORA15 18S:1371 H/ACA
SNORD59 18S:A1029 C/D
SNORD59 18S:A1029 C/D
SNORA36 18S:A103,18S:U1248 H/ACA
SNORA36 18S:A103,18S:U1248 H/ACA
SNORA36 18S:A103,18S:U1248 H/ACA
SNORD45 18S:A159 C/D
SNORD45 18S:A159,18S:U172 C/D
SNORD44 18S:A166 C/D
SNORD27 18S:A27 C/D
SNORD16 18S:A489 C/D
SNORD16 18S:A489 C/D
SNORD70 18S:A517 C/D
SNORD70 18S:A517 C/D
SNORD62 18S:A591 C/D
SNORD62 18S:A591 C/D
SNORD62 18S:A591 C/D
SNORD57 18S:A99 C/D
SNORD66 18S:C1276 C/D
SNORD66 18S:C1276 C/D
SNORD28 18S:C1395 C/D
SNORD43 18S:C1708 C/D
SNORD14 18S:C467 C/D
SNORD14 18S:C467 C/D
SNORD14 18S:C467 C/D
SNORD56 18S:C522 C/D
SNORD100 18S:G441 C/D
SNORD11B 18S:G514 C/D
SNORD11 18S:G514 C/D
SNORD103 18S:G602 C/D
SNORD103 18S:G602 C/D
SNORD85 18S:G602 C/D
SNORD19 18S:G684 C/D
SNORD19B 18S:G684 C/D
SNORD19 18S:G684 C/D
SNORA57 18S:U1002 H/ACA
SNORA57 18S:U1002 H/ACA
SNORA57 18S:U1002 H/ACA
SNORA57 18S:U1002 H/ACA
SNORA57 18S:U1002 H/ACA
SNORA57 18S:U1002 H/ACA
SNORA76 18S:U105 H/ACA
SNORA76 18S:U105 H/ACA
SNORA76 18S:U105 H/ACA
SNORA76 18S:U105 H/ACA
SNORA76 18S:U105 H/ACA
SNORA8 18S:U1054,18S:U1079 H/ACA
SNORA8 18S:U1054,18S:U1079 H/ACA
SNORA8 18S:U1054,18S:U1079 H/ACA
SNORA8 18S:U1054,18S:U1079 H/ACA
SNORA8 18S:U1054,18S:U1079 H/ACA
SNORA8 18S:U1054,18S:U1079 H/ACA
SNORA8 18S:U1054,18S:U1079 H/ACA
SNORA8 18S:U1054,18S:U1079 H/ACA
SNORA42 18S:U109 H/ACA
SNORA42 18S:U109 H/ACA
SNORA42 18S:U109 H/ACA
SNORA42 18S:U109 H/ACA
SNORA42 18S:U109 H/ACA
SNORA42 18S:U109 H/ACA
SNORA42 18S:U109 H/ACA
SNORA42 18S:U109 H/ACA
SNORA42 18S:U109 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORA42 18S:U109,18S:U573 H/ACA
SNORD42 18S:U116 C/D
SNORD42 18S:U116 C/D
SNORA66 18S:U119 H/ACA
SNORA66 18S:U119 H/ACA
SNORA66 18S:U119 H/ACA
SNORA66 18S:U119 H/ACA
SNORA66 18S:U119 H/ACA
SNORA66 18S:U119 H/ACA
SNORA66 18S:U119 H/ACA
SNORA66 18S:U119 H/ACA
SNORA66 18S:U119 H/ACA
snoZ17 18S:U121 unknown
snoZ17 18S:U121 unknown
SNORA5 18S:U1242,18S:U1629 H/ACA
SNORA5 18S:U1242,18S:U1629 H/ACA
SNORA5 18S:U1242,18S:U1629 H/ACA
SNORA5 18S:U1242,18S:U1629 H/ACA
SNORA5 18S:U1242,18S:U1629 H/ACA
SNORA5 18S:U1242,18S:U1629 H/ACA
SNORA36 18S:U1248 H/ACA
SNORA36 18S:U1248 H/ACA
SNORA36 18S:U1248 H/ACA
SNORA13 18S:U1252 H/ACA
SNORD110 18S:U1292 C/D
SNORD33 18S:U1330 C/D
SNORA4 18S:U1351 H/ACA
SNORA4 18S:U1351 H/ACA
SNORA4 18S:U1351 H/ACA
SNORD61 18S:U1446 C/D
SNORA67 18S:U1449 H/ACA
SNORA67 18S:U1449 H/ACA
SNORA5 18S:U1629 H/ACA
SNORA5 18S:U1629 H/ACA
SNORA5 18S:U1629 H/ACA
SNORA5 18S:U1629 H/ACA
SNORA41 18S:U1647 H/ACA
SNORA41 18S:U1647 H/ACA
SNORA41 18S:U1647 H/ACA
SNORA41 18S:U1647 H/ACA
SNORD82 18S:U1680 C/D
SNORA70 18S:U1696 H/ACA
SNORA70 18S:U1696 H/ACA
SNORA70 18S:U1696 H/ACA
SNORA70 18S:U1696 H/ACA
SNORA70 18S:U1696 H/ACA
SNORD45 18S:U172 C/D
SNORD20 18S:U1807 C/D
SNORA31 18S:U218,28S:U3045 H/ACA
SNORA31 18S:U218,28S:U3045 H/ACA
SNORA31 18S:U218,28S:U3045 H/ACA
SNORA50 18S:U34 H/ACA
SNORA50 18S:U34,18S:U105 H/ACA
SNORA55 18S:U36 H/ACA
SNORA55 18S:U36 H/ACA
SNORA71 18S:U411 H/ACA
SNORA71 18S:U411 H/ACA
SNORA71 18S:U411 H/ACA
SNORA71 18S:U411 H/ACA
SNORA71 18S:U411 H/ACA
SNORA71 18S:U411 H/ACA
SNORA71 18S:U411 H/ACA
snoMBII-202 18S:U433,28S:A2177 unknown
SNORA42 18S:U573 H/ACA
SNORA42 18S:U573 H/ACA
SNORA42 18S:U573 H/ACA
SNORA42 18S:U573,18S:U109 H/ACA
SNORA24 18S:U610 H/ACA
SNORA24 18S:U610 H/ACA
SNORA24 18S:U610 H/ACA
SNORD65 18S:U628 C/D
SNORA46 18S:U650 H/ACA
SNORA20 18S:U652 H/ACA
SNORA20 18S:U652 H/ACA
SNORA20 18S:U652 H/ACA
SNORA44 18S:U687,18S:U823 H/ACA
SNORA44 18S:U687,18S:U823 H/ACA
SNORA44 18S:U687,18S:U823 H/ACA
SNORA44 18S:U687,18S:U823 H/ACA
SNORA44 18S:U687,18S:U823 H/ACA
SNORD105 18S:U800 C/D
SNORD105B 18S:U800 C/D
SNORA25 18S:U802 H/ACA
SNORA25 18S:U802 H/ACA
SNORA25 18S:U802 H/ACA
SNORA25 18S:U802 H/ACA
SNORA25 18S:U802 H/ACA
SNORA25 18S:U802 H/ACA
SNORA25 18S:U802 H/ACA
SNORA25 18S:U802,18S:U815 H/ACA
SNORA25 18S:U802,18S:U815 H/ACA
SNORA25 18S:U802,18S:U815 H/ACA
SNORA77 18S:U815 H/ACA
SNORA77 18S:U815 H/ACA
SNORA77 18S:U815 H/ACA
SNORA28 18S:U816 H/ACA
SNORA28 18S:U816,18S:U867 H/ACA
SNORA28 18S:U816,18S:U867 H/ACA
SNORA28 18S:U816,18S:U867 H/ACA
SNORA28 18S:U816,18S:U867 H/ACA
SNORA28 18S:U816,18S:U867 H/ACA
SNORA28 18S:U816,18S:U867 H/ACA
SNORA28 18S:U816,18S:U867 H/ACA
SNORA44 18S:U823 H/ACA
SNORA24 18S:U864,18S:U610 H/ACA
SNORA28 18S:U867 H/ACA
SNORA28 18S:U867 H/ACA
SNORA28 18S:U867 H/ACA
SNORA28 18S:U867 H/ACA
SNORA28 18S:U867 H/ACA
SNORA28 18S:U867 H/ACA
SNORA28 18S:U867 H/ACA
SNORA28 18S:U867 H/ACA
SNORA75 18S:U93 H/ACA
SNORA14 18S:U964 H/ACA
SNORD32 28S:A1410,18S:G1332 C/D
SNORA40 28S:U3896,18S:U1178 H/ACA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved