snOPY snoRNA Orthological Gene Database
Mus_musculus
U12 snRNA
NR_004432
150
NTGCCTTAAACTTATGAGTAAGGAAAATAACGATTCGGGGTGACGCCCGAGTCCTCACTG
CTTATGTGAGAAGAATTTTTGAGCGGGTATAGGTTGCAATCTGAGCGACCCGCCTACTTT
GCGGGATGCCTGGGTGACGCGATCTGCCCG
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved