snOPY snoRNA Orthological Gene Database
Mus_musculus
U4 snRNA
MUSUR57T
145
GAGCTTTGCGCAGTGGCAGTATCGTAGCCAATGAGGTTTATCCGAGGCGCGATTATTGCT
AATTGAAAACTTTTCCCAATACCCCGCCGTGACGACTTGCAATATAGTCGGCATTGGCAA
TTTTTGACAGTCTCTACGGAGACTG
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved