snOPY snoRNA Orthological Gene Database
Mus_musculus
U5 snRNA
MUSUR5
118
GATACTCTGGTTTCTCTTCAGATCGTATAAATCTTTCGCCTTTTACTAAAGATTTCCGTG
GAGAGGAACAACTCTGAGTCTTAAACCAATTTTTTGAGGCCTTGTCTTGGCAAGGCTA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved