snOPY snoRNA Orthological Gene Database
Mus_musculus
U2 snRNA
NR_004414
187
ATCGCTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATAT
CTGATACGTCCTCTATCCGAGGACAATATATTAAATGGATTTTTGGAAGTAGGAGTTGGA
ATAGGAGCTTGCTCCGTCCACTCCACGCATCGACCTGGTATTGCAGTACCTCCAGGAACG
GTGCACC
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved